Transcript

faimb-201

ID
ZDB-TSCRIPT-090929-17075
Name
faimb-201
Previous Names
  • faimb-001
  • zgc:92712-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036612 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036612|OTTDARG00000027281|ZDB-GENE-040718-91 faimb|OTTDARP00000029370 CH211-194E2.1-001 LG_ CR854926.5 Danio rerio protein_coding KNOWN, 840 bp
ACACTAATGCCACTTGTTGCTGAGCGAGCATGGGATGGCA
AACTCCTCAAGAATATACAGAGATTTAATCGGCAGTTACA
CATGATGAAGATTATTATGACCAGGCTCAGGCTAAAACAT
TATATGGAAATAAAAATACTGTAGACCTGTGCAGTTTGGA
TCTGAAAACATCTGAGCATGTCCGGAGACATTGTGGGAGC
GTGGGATGTGTCCCTGAGCGATGGGCTTTACCGAATTGAG
TTTGAACACGGATCAACGACAGGAAAACGTGTCATTTATA
TTAATGGAAAGGAGGTGTTGAGGAGAGACTGGATGTTCAA
ATTGGTGGGCAAAGAAACATTCCCTGTTGGCTGTACAGAT
GCAAAAGCAACCATAACTATTGAGGCCATCACTGGGTTTT
CCTATGAGTACACGCTGGAGATCAACGGAAAAAGTCTGCA
AACATTTCTGGACAACCGATCAAAAATTTCCAAAACATGG
GTTATGAAGCTGGATGGTGCCGATTACAGGATAGTTCTAG
AGAAAGACACTATGGATGTTTGGTGCAATGGACAGAAACT
GGAGACTATGGGAGAGTTTACAGAGAACGGATCAGAGACA
CACTTTGCACTGGGGGACCATGAATGCTACATTAAGGCAA
CAACTAGTGGACGAAAGAGAAACGGAATAGTTCATTCCTT
ACTGGTGGATGGGATCAGGATAGAAGAGGCCATTGAGTGA
AATGGAGGCTAATAGAATTCAGCTGTGCAAGACATTTAGC
AACAGTGTACTTTAGCACAATTAGATACAGATGGCACTGA
ATTGATTTTTTCTTCCTCAATAAATCCAATATGTTGGCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations