Transcript

bysl-201

ID
ZDB-TSCRIPT-090929-1689
Name
bysl-201
Previous Names
  • bysl-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000010333 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000010333|OTTDARG00000009007|ZDB-GENE-040426-1287 bysl|OTTDARP00000008905 RP71-11B17.5-001 LG_ AL645789.14 Danio rerio protein_coding KNOWN, 1504 bp
CTCTCAGCGCCATTGCTCTCAGACCCACGTGTGTGCAGCT
CTCCGCGGCGCGTCATGTGTTCAGACGCGATTTCACACTC
ATAATTCCTCAGACAGACAGGCAGATAATACTAATATTGA
TAACCGTCATCATGCCGAAGGTGAAGAAGGCCTGGAGCGG
CGGCGCGGTGCCCCTGGCCGAGCAGATCCTCCAGCGGGAC
TCAGTGCGCTGCAGCGGCCGGCAGAAGCAGCGCGGCCGCG
GGCAGGAGGAGCAGCAGGAGTTCGTGGATGAGAAGCTGAG
CCGGAGGATCCTGGAGCAGGCCCGCAGACAGCAGGAGGAG
CTGCAGGACACAGCCGAGGAGGAGCGCAGGACACCGGCGA
CCAGACTGGGGCCGGTGTCTCAGGATGGAGACTCTGATGA
GGAATGGCCGGCTCTGGGTGAAGCCATGGACGAGGTGGAG
CCAGAGGTGGAGGTGGACCCGGAGGACGAGCAAGCCATAC
AGATGTTCATGAGCAAAAACCCGCCGATGCGACGCACACT
GGCCGACATCATCATGGAGAAGATCACGGAGAAGCAGACG
GAGGTGGGGACGGTGTTGTCGGAAGTGTCGGGTCACGCGA
TGCCTCAGATGGACCCGCGAGTGGTGGAGGTGTACAGAGG
GGTCAGCAAGGTTCTGTCGAAGTACCGCAGTGGGAAACTG
CCCAAAGCCTTTAAGATCATCCCAGCTCTGTCCAACTGGG
AGCAGGTGCTGTACCTGACAGAGCCCGAGACCTGGAGCGC
CGCCGCCATGTACCAGGCCACTAGGATTTTCTCCTCGAAC
CTGAAGGAGCGAATGGCCCAGCGCTTCTACAATCTGGTGC
TGCTGCCCAGAATCAGAGACGACATCGCGGAGTACAAGCG
GCTCAACTTCCACCTGTACAGCGCTCTGAAGAAGGCCCTG
TTCAAACCCGCAGCCTGGTTCAAAGGGATCCTGCTCCCGC
TCTGTGAGTCCGGCTCATGTACACTGAGGGAAGCCATCAT
CATCGGCAGCATCATCACCAAATGCTCCATCCCCGTGCTG
CACTCCAGCGCTGCGATGCTGAAGCTGGCTGAGATGGAGT
ATAACGGAGCCAACAGTATTTTCCTGCGTCTGATGCTGGA
TAAGAAGTACGCTCTGCCGTTCCGCGTGCTGGACGCGTTA
GTCGCGCACTTTCTGTCGTTCCGCACGGACAAACGGATCC
TGCCGGTGCTGTGGCATCAGAGCCTGCTGACGCTGGTGCA
GCGCTATAAAGCAGACCTGTCCTCCGAGCAGAAGGAGGCG
CTGTTGGAGCTGCTGAAGGCCCACACACACCCGCAGATCT
CCAGCGAGATACGCAGAGAACTGCAGAGCGCCGAGCCTCG
AGACCTGGAGGACGCCACGCCGGCCATGAGCCTCGACTGA
CGGACTAACATGAGATTTGACAGTGCAGTGTGTGTCGCAG
TCATGTTTCTGGACTGATTGGGTTATTCTGGTATTACATC
AGGTCATTAAATTGTGTTATACTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations