header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-16753
Transcript Name: abcg2d-201
Previous Name: abcg2d-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036249 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036249|OTTDARG00000027083|ZDB-GENE-050517-38 abcg2d|OTTDARP00000029090 abcg2d-001 LG_ CR788312.9 Danio rerio protein_coding KNOWN, 1842 bp
ATGCCTGACAATGCTGTCTTTGAGCATGATCAAATCTCTG
AGGAGACTGGCAGGAATGGGCAGAACGGGTCAAAGATCAT
CATCATGGAGCCCATGAAGAAGCAGCACGGAGCCACGGTC
AGTTTCCACAGCATCCGCTATAGAGTGGAGCAGAAAACCG
GACCCGTTTGCAGGAGAACAACAGTCCAGAAGGAGATCCT
GCTGGACCTCAATGGGATCATGAGACCTGGTTTAAATGCT
ATTTTGGGTCCTACGGGAAGTGGCAAATCTTCGTTTTTGG
ACGTCCTTGCTGGCAGGAAGGATCCCGCTGGTCTTTCTGG
TGAAGTTCTCGTCAACGGAGCCCTACAGCCGGCCAATTTC
AAATGTCTTTCTGGCTACGTTGTCCAGGATGACATTGTAA
TGGGCACTCTAACGGTGAGAGAGAACCTGAGTTTCTCAGC
TGCTCTGCGTTTGTCTTCTCATGTCAGTCCCAGAGAAAAG
GAGGCAAGAGTCAACCATCTCATCTCCGAGCTGGGCCTCA
ACAAAGTCGCAGATTCCAAGGTGGGCACTCAAATAATCAG
GGGGATCTCGGGTGGAGAGAGGAAGAGGACCAGCATCGGG
ATGGAGCTGATCATTGACCCCTCTGTGCTCTTTTTGGATG
AACCCACCACCGGTTTGGACGCTAGTACAGCTCATTCTGT
GCTGCTGCTGCTCAAGAGAATGGCGGGTCAGGGTCGCACC
ATCATCATGTCTATTCACCAGCCACGCTTCTCCATCTACC
GGCTCTTCGACAGCCTCACCCTGCTGGCCAACGGCAAACA
AGTCTATCACGGACCTGCTCAAGACGCCCTCGACTACTTC
AGCAACATCGGATATGCTTGTGAGGCTCATAATAACCCGG
CGGATTTCTTCTTGGACGTCATCAATGGCAGCTCAGTGAC
GAAGATTCAGAATAACGGAGATGCGGAGTGTGACGTGTCT
GCTGTCAGTCGTCAGTCTGTGGAAGATCAGCTGATGGAGA
AATACAGAAGCTGTAGCTTCGCTCGTGCTGTCAGAGCAGA
GCTGGATCACATCATCCAGACCAAAGACAGCAGCAGCAGC
AGCGTCGCAGCCGAATGCCACAGCATCACCTACAGCAGCT
CCTTCTGCCAGCAGCTCCGCTGGGTCTTATGGAGAACCTT
CTGGAATCTCATGCTCAACCCACAGACTTCAGTAGCTCAG
TTGGCAGTCACGACTCTGATGGCGGCCATTGTTGGTGCCA
TCTTCTACGGGGTCAAGGATGACCAGAGTGGCATACAAAA
CAGGCGAGTTGATCACTTTTATCATGAATACACAAGTGGA
TACTACAGGGTGTCTGTCTTCTTCCTGTCTAAAATCCTGT
CTGACATCATCACCCAGCGCACAATCCCTAGTGTTCTCTT
CAGCTGCGTGGTGTATTTCATGATAGGTTTGAAGCCCACA
GCATCTGCGTTCTTCATCTTCATGTTGACGGTGATTCTGG
TGTCTTGTACGGCAGCGGCGATGGCCATGGCAATATCAGC
TGACCAATCAGTGGTGGCCGTCGCCAACATCCTCATGACC
GTCAGCTTCATCTTCATGATGGCAAGTTCGCATCTTGTCA
CGACACAAAATATCTTCTCTGGTCTGCTGGTCAATCTGAA
GAGCATCATGGACTGGCTCTCCTGGCTCAAGTATCTCAGC
ATCCCTCGATACGGCCTCGAGGAGCATCCAGGCTTTCAGC
TGATGAGATGTTTTGATGAATATCTTGAACAGGCGCTGGA
GATCAATGAGTTTGTGGGCCTGAGCTTTTGTGGAAACGTG
TCTGAATCGCTGGCCAGTCCTGCTGCACACGTCCTCATGT
AG

abcg2d TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA abcg2d-201 1842
abcg2d-202 (1)    Ensembl 2112
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
abcg2d-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000036249 (1),  Ensembl_Trans:ENSDART00000022733 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:DQ223861 (1) 1842 bp
CITATIONS (2)