Transcript

prpf40a-201

ID
ZDB-TSCRIPT-090929-16606
Name
prpf40a-201
Previous Names
  • prpf40a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036064 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036064|OTTDARG00000026980|ZDB-GENE-030131-274 prpf40a|OTTDARP00000028938 prpf40a-001 LG_ CR925815.26 Danio rerio protein_coding KNOWN, 3285 bp
ACTCGTACTTACGCTTCACGTCTGCGTCTTGTTTGCGCAG
CTTTACAGTTGCTTTCTCCCCCTGCAGTTCAAACCCGTGC
ATGCGCATGCCCTACCCATTGTAGTTGCACTGAAGCACAA
CTCTGTAGTTTGAACCCGGCGCGAGGCAGCCAATCAGAAC
GTAGGTTTTTGTCTCGCGGAGGGCCGCTGCATGTTCTCTC
ATCATGATGGGGCCACCAGGAATCCCGCCTCACTTCCCTC
CAATGGGAATGCCACCCATGGGCCAGAGGCCGCCCAGCCT
GGCCCCCATGCCCCCGGGAATAATGCCACCCATGATGCCT
CCAATGGGCGCTCCACCAATTGGACAGATGCCAGCCATGA
TGCCACCAATGATGCCTGGAATGATGATGCCACCTCGTCT
GCCAGCTGCATCAATCCAGCCTACAGGACCGCCTGGTGTA
AGTCCAGTGGAGGCTGCAGCTCCGGCTGCTCCTGGAACAA
CCAGCACCACATCAACCGAGTCTTCACCTGATGAACAGCC
AAAAAAGAAGTCAGTGTGGACCGAGCACAAATCTCTGGAT
GGAAAAATATACTACTACAACACAGAGACCAAACAATCCA
CCTGGGAGAAACCAGATGAACTCAAATCACCCGCAGAGCA
AATGTTGTCAAAATGCCCATGGAAAGAGTATAAGTCAGAC
ACCGGAAAGCCCTATTACTATAACTCCCAGACCAAAGAGT
CTCGCTGGACTAAACCCAAAGAACTGGAGGACCTGGAAGC
GATGATAAAGGCAGAGGAAAATGGGACGGCTGATGTTGTG
GCTCCTGGCACCACCCCTGCTCTCACAGCTCAGAATGAGT
CTTCTGTTACTGTGGCGCCGGTTGCTGAGACGGAGGCTAC
CATGGCGACGGGCACCATCGAGGAACAGCCTTCTCACGTG
CCTGCGCAGGTTGCTGAGGTCAGCAGTGATGTCGCTGTGA
ACTCCACTGAGGAAACGCCCAGCGTGGAGACCCAGCCTAG
CAATGACGTTTCAAAGGAGGAGAGACCTGAGCTGGTGAAG
AAAGTTTACAAGTGGAATACAAAAGAGGAGGCGAAGCAGG
CCTTTAAAGAACTCCTGAAAGAAAAGGGCGTTTCTTCCAA
TGCATCATGGGAGCAGGCAATGAAGCTGATAATTAATGAC
CCTCGTTACAGTGCTCTGCCAAAGCTCAGTGAGAAGAAAC
AGGCGTTCAATGCTTATAAAGTCCAGACAGAGAAAGAGGA
AAAGGAAGAAGCCAGAATAAAATACAAGGAGTCTAAAGAG
ACTTTCCAACGCTTCCTGGAGAACCACGAGAAGATGACGT
CAACCACACGATACAAGAAAGCAGAGCAGATGTTTGGAGA
TCAAGAGGTTTGGTCGTGTGTTCCAGAGAGAGACCGGCTG
GAGATCTATGAAGATGTGCTCTTTTATTTGGCAAAGAAAG
AGAAGGAACAAGCTAAACAGCTGAGGAAGAGGAACTGGGA
AGCACTGAAGAACATTCTGGACAATATGGCCAATGTGACG
TACAGAACAACGTGGTCTGAGGCGCAACAGTACCTGCTGG
ACAATCCAACATTTGCTGAAGACGAGGAGCTACAGAACAT
GGACAAGGAAGATGCGCTGATCTGTTTTGAGGAACACATC
CGTGCTCTTGAGAAAGAGGAAGAAGATGAGAAGCAGAAAA
CTCTGCTGCGCGAGAGACGTCGACAGCGCAAGAACAGAGA
GTCTTTTCAGAAATTCCTGGATGAGCTTCATGATCATGGG
CAGCTGCACTCCATGTCTGCCTGGATGGAGATGTACCCAA
CCATCAGTGCCGATATTCGCTTCAGCAACATGCTGGGCCA
GCCAGGCTCCACGCCTCTGGACTTATTTAAGTTTTATGTG
GAGGATCTGAAAGCTCGTTACCATGATGAGAAGAGAATCA
TTAAAGACATCCTGAAGGATAAAGGTTTCCTGGTGGAGAT
CAACACAGGCTTTGAGGACTTTGGCTCAGTGATCAGCTCT
GATAAACGCGCCACCACGCTTGATGCGGGAAACATCAAAC
TGGCCTTCAACAGTTTGCTCGAGAAGGCTGAAGCACGAGA
GCGGGAGAGAGAAAAAGAGGAGGCCAGAAAGATGAAGAGG
AAGGAAGCGGCGTTTAAGAGCATGTTAAAACAGGCCACAC
CCCCTCTAGAGCCCGAGGCCACGTGGGAGGGAGTACGAGA
GCGCTTCCTAAAAGAGCCTGCTTTTGAAGACATCACGCTG
GAGTCCGAGAGGAAGAGAATATTCAAAGACTTCATGCATG
TTCTAGAGCACGAGTGTCAGCATCATCATTCCAAGACGAA
AAAACACTCCAAGAAATCCAAGAAACACCACAGGAAACGT
TCCCGATCTCGATCAGGCTCGGAGTCAGAGGAAGATGAGT
ATCACACGAAGAAGAAGAAACGTTCAACATCTAAATCTCC
ATCTGAGCACTCGTCCTCTGGGGAGTCAGAGAGAAGTTAT
AAGAAATCGAAGAAACACAAGAAGAAGGGAAAGAAAAGAC
GACATAAGTCTGGTTCCCCTGAGTCTGAAGGAGAGAGAGA
GCGGAAAGGAAGAGAGAAGGACAAAGATAAAGAGAACGAC
AAATCCAGAGCCAAGCTGCGTGGAGAATCCAAACAGAAAT
CCCCCAAAAGAAAGAGTGCTAAAGAAGAGGGTGGATGGGA
TACGTCTGGCAGTGAACTGAGTGAAGGAGAGCTGGAGAAG
AGGCGGCGCACACTTCTAGAGCAGCTGGATGCTCCGTAAA
TCCCTCTGTTTGTATGTGTGTGTGTGTGTGTGTGTGTGTG
TTTGTCCATCTCCGCCTCTCTCTCTTGCATTCCTGTAATG
TTGTGTCCTCCTAGAGTTTGCTGGCAGAGTCTCTATCAGC
ATCTGAGCAGTGGATATTCAGATGAATCTCTGCGAGAGAC
ACGGTTTGTCTGAACATCAGCACTCTTCTTCATCTGGGCA
CATGCTTGATTTTGTTTTTGTAAGATTATTTTCAGAGGTT
GCAAGCGTTATGTTGCCTTTAACTGCAGAACCTTTTTTTA
GGTAGTTGTAAATTTGTTATTGCCAATAGTTTTAAACATT
ACCGGAGGAAATTACCAAGCCTGAAGAAAACAAAGAACAC
ACCTGATATTCAGCTTCAGATTAATCTGTACAATTGTATG
TGGAAGCCATTTTTGGAAAGCAATGTTATTATCCGTATGA
AAGTAAATCAAATATCTGCAGCATTGTTTTCAACTTGAAT
TTTGACAAATAAACTATGAAAAAAGGTTTCTTTGTTGCTT
TATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations