Transcript

rnf10-201

ID
ZDB-TSCRIPT-090929-16465
Name
rnf10-201
Previous Names
  • rnf10-001
  • si:ch211-15b7.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000035909 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000035909|OTTDARG00000026892|ZDB-GENE-030131-2969 rnf10|OTTDARP00000028808 CH211-15B7.3-001 LG_ CR382384.18 Danio rerio protein_coding NOVEL, 3671 bp
CTCCGAGGCTTATAACCCTCATCCGGGTGTTTACGGTTCC
CGATTGGCGACCCGTCGCCATATGTCTGTATTTCCTTAGC
TGGAGTAAGATTTGGGTTAAAACCCATTTATTTAACCGTT
TTCCTCTTTTGGAAAACGGCTAACGCCTTGTGGGGCGTAA
CACTTCCCACGCCGAGGAGAAACTGCGCTTTTCAAGGGGC
GAGGCCCCGCTTTTTGGGCACTTGTTTTTTGTGTTAGCAC
ACAGGCTTTTTTAACTGAGACATTTGGATTGTGTCTCTGT
TTTTCTCTTGGTTTGTTTGTGGTCAAGATGTCGCCGTAAT
GGGGTCTCCGTGTTTGTCAGAAATGAATAAGGGCCTTCGT
TGCCTGACCCGCAGCCGCAACAACTCGTTTACCCCGTTTA
ATGCTAGAGAGCTCGGAGGCTCTCACCCCGGAGTTCGGCC
TCAACATGGAGAAAAATCCAAACGCCAACAACAACAGCAG
CAGCACGAAGATCCCGCCCCGTTCCAGCTCTACAGGCCTC
AACCCGACAGACTCTAAAGCCAAAACAGATGGTAAAAATA
ATGGGGGCTCTAAGCGCTACAGCCGTAAGCGGGAGCCCAC
TTTTGCCAAGGCTGAGAGCTTTCCAGGCCCACGCCGCTCA
CAGCCACAAAAAAATAAGAATTTTGACAAGAGACCCCCTC
AGAGAGGTGGCGCAGGGGTGCGACAGTATGGACTCGCTGG
TGGTGGGAGAAGAGAAGAGGTAGCAGAAAACCGCCGGGCA
GAGTTTAGCCCGGCTCAGTTTGCTGGACCCAAAAAGATAA
GTCTGAACCACCTGCTCAACTTTACATTTGAGCCAAGAGG
AGGCCATTTTGGCTCCGGAGGAGATGGCCATTCCTGCTGG
GGTCGCCGCAACAAGTGGGGTCACAAACACAAGCCCTTCA
ACAAGGAGCTTTTCCTACAGGCTAACTGCCAGTTTGTGGT
AAGTGATGATCAGGACTATCAAGCCCATTTCACTGATCCA
GACACTTTGGTGGACTGGGACTGCGTGCAGCAAGTGCGTA
TCTACAGTCATGAGGTGCCGTCTTGTCCGATCTGCCTGTA
TCCCCCAGTGGCGGCCCACATGACGCGCTGCGGCCACATC
TACTGCTGGCCATGCATGCTGCACTACCTCTCTCTGAGCG
AGAAGAGTTGGTCTAAGTGCCCCATTTGCTATGAGGCCGT
GCACAGCGCTGATCTCAAGAGTGTGGTTGCAATGGAGACC
CGTCAGTATGTGTCTGGTAACTCCATCACGATGTGTCTGA
TGCGAAGAGAGAAAGGATCTCTGGTTGCTCTTCCCAGCTC
TCAGTGGGTTAAAGTGGAGGAGCCCATTCAGTTTGGAGAT
GTGCAATTTTGTTCATACTCCAAGCTGCTGCTGGCATCTC
GGCAGCAGGTTTTGGGTCTGCTGGCTGAAGAGAGGATGGC
TCTCCAAACCCAGCTCAGCCAGGAGAAAGATGACCCACAG
GCCTGTTTCATACAGAGCGCTTTACTGCAGCTGCAGGAGC
GTGAGGAAAGTCTTTTGAAACGTCGTCGTCGTAAGACTGC
AGGTTCTGTTGATGGGGTGGACATGAGGAAACTCTCTCTG
TCTGAACAATCCTCTCCAGAGGTGACTGTGGTCAATAACC
TCACAAACTCGAAGCCCATTCTGCAGTATGCTTCAGCATT
TGACGATGAGGTACAGGATGCTCAAGAAGAGGTGCTGGAG
GAAATGACCAATCCCAGTGTTCATGAAGCGCCTGAAGAGA
TACCTGATGGAGACGTGGAGGACCTTCCTGTAGAAGAGAC
TCCTCAATCCAGTCAGACCGCTCATCATGGCCCATATTAC
TACTTCTATCAGGCTGAGGACGGTCAGCAGATGTTTCTTC
ACCCAGTGAACGTGCGCTGTCTTCAGAGGCAGTACGGGAG
CTTGGAGAACAGCCCTCAGACCATCACTGCTAATGTTGTG
GAGATTGATGGACAAACGGTCACTGAGGATATTCGTCGTC
GGCACCGTTACCTATCTCACCTGCCCCTCACCTGTGAGTT
CAGCCTCTGTGAGCTTGATCTTCAGCCACCCATTCTCTCG
AAAGAAACATTGGACAGTTTTGCAGATGATATTGAGAAAA
GGAAGCGCTTAAGGCAGAAGAAAGTGAGGGATGAGAAGAG
AAGGGAGAAGAGGATTGAGATGGAGGAAAATAGGAAACAG
GGCAAATACCCAGAGGTGCACATTGGGCTGGAAAACCTCC
ATCATTTTCCAGCTTTTGGTTCTCCTCCTCAGAACGGTCC
ACAGCTGCATCTTCCAGAGGTTCTGCTGGGACCCCCTTCT
CCACTGAGCAGCAGCCCGTCTTCAGATGGAGTGATGTTCC
CTAATCTCAGTGAGCACAGTCCTTCTCTGAGTGTTGTCGG
TGTGGAAGAAGACTCTCACTGCATGTCATTCGCTCAGATG
CTGAAAGGTGGCAAAGCACGTGTGGATACGGGGCCTAAAA
CTACCCCAAAGAAAGCAGACATGTTTCTGGCTCCTCCTGC
AGCAGACAGTGATGGAGAGAGTGATAACTCTGATCGGGTC
CCTGTACCCAGTTTCCAGAACTCCTTTAGTCAGGCTCTGG
GACAGGCTCTATCAAAGCTGGACAATGGAAATCAAACCCC
AGCCCCAGCTTTACCCATTTCTGATGATAAAGGCGGGAAG
AAGAAAAAGAAAAAGCAGAAGCTTCTGTTCAGCACCTCTA
TGGTTCACACCAAGTAAACACTGAAGTTCACCCTGTCACT
CCTCCTGCCTTATTCCTCCCTTTCGCTTGGCTTTCATCAT
CTCCCTTCCCTCTCCTCCTTCATTTCCCTGTTCAATGAGA
TTTTTCTCCACAGGAAGTTCATAGGGTTCTGGATTACTCT
CTTTAGATCAGATTCATATGACTTTTCACTGTAGTTCTGT
GCAGATTCTAAATTGCTCAAGTTAAATATCATGGTTGCTG
GTTAAGGGTTGCACTGATAGATTTTGGGAGTCTTGAGGTC
TCGGTCAGCCAGCTGCAGACACGTCCCGTCCCCATTTATC
AGACAACATTTTACTTCAACCGTGATGCTTCATTCTGAAC
TCAAATCAAACAAAAATGAATTAAAACAAAACATTGAAAA
TTGCAAAAGAGGAAGAACGTGATGAGGATTGTATGCATTT
GAGTTCTTCCTGTGATGCACAGACACTTAAAACTATGCTG
ATTTGAACACATTTCTGCTTGCTTGTACACGCACACACCA
ACACTTCTTCTTTTTCTTCCTTTTATTTTCTGATTATTGT
GAACTTCAGTCAGTCTGTGTTCAGCTGTCATCATCTGGCC
AGCCTGAGAACTGCCTTTCACAATCAGAGATGTTCATAAT
TCACAAACAAGAAGTCATATTTCTGCTGGAATAGCATAGT
GGGTCTTAAGCACTTGACTATTGGAACCTTTATTGATTCA
TTTATTCAACTGTTAGACAGATTGAGAGCTGCTCATGTTC
AATAGTGTTCAGAGAAGAGCTTCTGTGTTGAGTGAGGATG
ATATGTAAAGGCACAGAGAGGCTTTATGAAATGTTCTAGA
GGGTTTGATTTTCTTTTCTTTCTCTATATTTCATTATTTT
CCCTCATGTGGTAAAAAGTTCTTGCATTTAGAGTAAGTTG
GAATGAATAAAGGATTATTATGCACTGGCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations