Transcript

gopc-002

ID
ZDB-TSCRIPT-090929-16321
Name
gopc-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000035733 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000035733|OTTDARG00000026803|ZDB-GENE-030131-5086 gopc|no_translation gopc-002 LG_ CU138502.20 Danio rerio protein_coding KNOWN, 728 bp
GATCTCACCTCACTTTTGTGAAGTTGTAGTTGTTGTGGTG
AAGAAGGTCTTCGTTTCTCTTGTCCTCTTGCACTGCACAT
ACAGAACAGCAATTTAATGACATAATGTTCAGACCCTTAA
CACACATCGCATTTGTTTGATACTCTATACTCACATCTTG
TCTTTGTTCGATTGTTTATTACAGGAGAAGGAATTGGAGG
CCAGTAAGAAGGAAAAAGTCAAGGAGGTCAAGCTGGAGGC
AGAGGTTAAGATGCTAAAGAAGGAGAACGAGGCCCTCCGA
AGGCACATTGCTGTGCTGCAGGCTGAGGTTTATGGAGCCA
GGCTGGCAGCCAAGTACCTGGATAAGGAGCTGGCTGGACG
GGTACAGCAGATCCAGTTGCTTGGGCGAGACATGAAAGGA
CCAGCTCATGATAAACTGTGGAACCAGCTTGAAGCAGAGA
TTCACCTGCATCGCCACAAAACAGTGATCCGAGCCTGCAG
GGGGCGCAACGATCCCAAGAAACCCTTGCCATCACCTGTA
GGCCATGACACAGATTCTCTGAAAAAGACTCAAGGAGTGG
GCCCTATACGCAAAGTGGTTCTGACCAAAGAAGATCATGA
AGGACTTGGCATCTCCATTACTGGCGGTAAAGAGCACGGC
GTTCCCATCCTCATCTCCGAAATCCACCCTACCCAGCCTG
CAGAGCGCTGCGGAGGACTGCATGTGGGAGATGCCATATT
AGCCGTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations