Transcript

vps35-002

ID
ZDB-TSCRIPT-090929-163
Name
vps35-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000002297 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000002297|OTTDARG00000002130|ZDB-GENE-030131-2042 vps35|OTTDARP00000002029 RP71-34G2.3-002 LG_ AL928906.4 Danio rerio protein_coding NOVEL, 763 bp
TCGAAGCGACGTTAAATTATTTTATTGTCATTAGATGCTA
ACCGAATGTTGTTCAGAGAAACTATTATTTTCTAAATACA
ATTTACCTCAGTTATTATTCTATAATGACACAACGCAGCT
AATTTTACTATTATGGATACATAAATAATAATTCTCAGTA
TTGTTTCTAGAGGGTTTTAAAGACGGATAATACAGCTTTT
ATGTCTTGTGATGTGTGCGGGCAGCGCTCGTCATGAGGCG
GAACAGCAGCAGTCACATGATACGACACATTCACAGGGGG
GTCATCCAGTATTTCCTCTAACATACCTGATAATCATGCC
CACCACACAGCAGTCGCCGCAGGATGAGCAGGAGAAACTG
CTGGATGAAGCTGTGCAGGCAGTCAAGGTTCAGTCATTTC
AAATGAAGCGCTGTCTGGACAAGAACAAGCTGATGGATGC
ACTGAAACATGCCTCAAATATGCTGGGGGAGTTGAGGACG
TCCATGCTCTCTCCTAAGAGCTATTATGAACTCTATATGG
CCATTTCAGATGAGCTGCATTACCTGGAGGTGTATTTGAC
TGACGAGTTTGCCAAAGGTCGCAAAGTGGCTGATCTCTAT
GAGCTTGTTCAGTATGCAGGGAACATCATCCCTCGACTGT
GAGTATCAAAAGTCTCTTTTCAGGAAAGTCTGTTCACTCA
GTGACCATATTTGCAACGCCTCCAGGCAGCTATTTTGGGC
ATACAGATTCAAGTCCTATATGTTTCAATAGAGTGCATTA
GAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations