Transcript

nkain1-202

ID
ZDB-TSCRIPT-090929-16157
Name
nkain1-202
Previous Names
  • nkain1-002
  • zgc:65908-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000035544 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000035544|OTTDARG00000026692|ZDB-GENE-040426-1472 nkain1|OTTDARP00000028561 nkain1-002 LG_ CU207343.7 Danio rerio protein_coding KNOWN, 966 bp
AGAGAAGGATGGTGGCTCAAGCTACACCGCCGGTTTAGTA
ATTCAGCTCATAAAAACCAACACCGGAGCTCACGGTAAGT
CACAAAGGCTCCCTTTGTGTTGGTTTCATTGGCGTTATTT
TCTTACCTCGCGCTCTTATATACACCCCCCGCTCCGTCTG
ATGCTTATCATATGATGCTCATTTCTGCCTGTTAATCGCG
CCCGTTGACTCTTCCTCTGTTCTTTGTGCTATTTTTGGGG
TCTGGTACCCGGTACGGAATGAAGGTGTGGCAGATTGGCT
AGGATTTGAGACCGCAGTTTGGACGCTTTGATTCGGACAA
TTCGGCGGAGGAGCTCCGGAATGACCAGCGGACATCCGCG
AGCATCGACGCCGCGAAGCGTGCACTCGGCCCGGCGGGCG
TCTTGATGTTTTGACTGCTGATCGTGAAGCGCGCTGGAGC
TCACCGGGGACTCCGCTTTCTCCCGACGCCTCGCGGGGCC
CAAGCCGTGCCTCAAGCGCGAGAGCATGGGTCGGTGCGAC
GGGAGGTGCACGCTGGTGGTCATCTGCTGCCTGCAGCTGG
TCGCTGCATTACAGAGGCAGGTGTTTGACTTTATGGGATA
TCAGTGGGCTCCCATCCTGGCCAACTTCCTCCATATCATG
GCCGTCATTCTGGGAGTGTTTGGAACTGTGCAAGTCCGCT
CCAGATATCTGATACTGTATGCTGTGTGGCTTGTGGTCTG
GGTGGGCTGGAACTCGTTCATCATCTGTTTTTATCTGGAA
GTTGGTCACCTGTCTCAGGACAGGGATTTCCTGATGACAT
TTAACACTTCGCTTCATCGCTCCTGGTGGATGGAGAACGG
GCCTGGTTGCCTAGTTACTCCAGTGCCTGATTCGCCATTG
GCTCCTCAGGATCATCATGTGATCACTGTCAGCGGCTGCT
TGCTGGACTACCAGTACATAGAGGTGGTCAGTTCAGCTCT
GCAAGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations