Transcript

aldh9a1a.2-201

ID
ZDB-TSCRIPT-090929-15957
Name
aldh9a1a.2-201
Previous Names
  • aldh9a1a.2-001
  • si:ch211-216k22.8-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000035304 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000035304|OTTDARG00000026544|ZDB-GENE-081104-507 aldh9a1a.2|OTTDARP00000028379 CH211-216K22.8-001 LG_none BX664618.13,BX927144.24 Danio rerio protein_coding NOVEL, 2291 bp
AATTGGTTCCTGTCAAGTTTACCATGGCTCAGCAACCGCT
TCTGTCGCTGCCCGAGTTCCAGAGCGTCTCCACAGGCACT
TTGGTGGTGAAGGAACCACTAAATTTCTGGGCAGGAGCAA
GAGTGAAGCCAAGTAACACGAAAAACTCCGAGCCAGTATA
CGAGCCTGCAACTGGTCGTGTGCTGTGTGATATGATTCCC
TGTGGAGAGGAGGAGGTAGATCAGGCTATTAAAAGTGCTC
ATTCTGCATACCTAAAATGGAGTCAATTATCAGGAATGGA
GAGGTCCCGAATCATGCTGGAGGCTGCCAGAATTATCAGG
GAGCGCAGGGATGCAATCGCAAAAACCGATGTGGCCAACA
ATGGCACGTCCATTACGGAGGCTAAGGTGGATATCGACCT
TGCTTGGAAGTGTATTGAGTACTATGCTGGCATTGCCCCC
ACACTGTCAGGTCAGCATATACAGCTTCCAGGAGGATCTT
TTGCCTACACCAGAAGAGAGCCTTTGGGAGTGTGCGTTGG
CATTGGTGCTTGGAATTACCCATTCCAGATTGCTGCTTGG
AAATCAGCTCCAGCTATAGCCTGTGGTAATGCCATGGTGT
TTAAACCGTCTCCCATGACCCCGGTGACTGCTGTCATGTT
GGCAGAGATCTACAAAGAGGCAGGTGTCCCAGATGGACTT
TTTAATGTGGTACAAGGGGGACCCGAAACAGGAAGCCTGC
TGTGTCACCATCCCATGGTGGCTAAAGTGTCCCTCACTGG
TGGTGTTCCTACTGGAAAGAAGGTTTTGGAAATGGCAGCT
AAAGGTGTAAAGCAGGTGACTCTGGAGCTTGGAGGAAAGT
CACCGCTGATCATCTTTAACGACTGTGAGCTGGAGAACGC
CATCAAAGGAGCCCTCATGGCCAACTTCCTCACCAAGGGA
GAGGTGTGCTGCAATGGAACAAGGGTGTTTGTGCAGAGGG
AGATCATGCCAAAGTTTTTGGAGGAAGTTGTGAAGAGGAC
CAAGGCCATCTCTGTGGGAGATCCTCTGTGTGAAGGAACA
CGCATGGGTGCTCTGATCAGCAAACCACACATGGAAAAAG
TGCTGGGCTTCATCAAGCAAGCTAAAGAGCAGGGTGCAAA
GGTTTTATGTGGAGGAGAACAATTTGTCCCCAATGATCCC
AAACTGAAAGACGGATACTTTGTGTCTCCATGTGTGCTGG
ATAACTGCAGAGATGATATGACCTGTGTGAAGGAGGAGAT
CTTTGGCCCTGTGATGTCTGTTCTGCCCTTTGACACTGAA
GAGGAAGTTCTTCAGAGAGCCAACAACACAACCTTTGGCT
TGGCATCTGGAGTCTTCACCAGGGATATTGCACGTGCCCA
CAGAGTCATTGCAAACCTTCAAGCAGGAATGTGCTACATC
AACAATTACAATGTTTGTCCTGTGGAAGTTCCTTTTGGGG
GCTACAAGATGTCAGGTTTTGGAAAGGAGAATGGCGCACT
GACCATTGAGTATTACTCTCAGCTCAAGACTGTTGTGGTG
GAAATGGGAGATGTGGAAAGCCTGTTTTAAGCTGTTGTCA
CAAAAGTACCCCTCAACATGTGAGAGCACTAGAAGAGAGT
TAACTGCTAACTGTTTAGCAAGTTTTAAAAAATAGTGTGA
ATTTTTGAAGTACTAATAGTTTTTGTCAAAAGTAAGTGTA
TCTGGATATGTTTCTATTTTAGAAGCACAAATGTATTACA
TTCCAGGACTTGATTTTTCACCACTGCACCATGATGAATT
TGTATTATACTGGTGATTTACAAGTTTCAGATTTAAATAA
TAGAGGCTTTCAGGATTAATAACTGACATTTTTCTCCTTT
TTAAACTGGATTGATGTAACATGTCTCTGGTTTTACAGGT
TCCTGTTGTTTGTCATTAGAAAATGATAGGAACTGGTGTG
AAAACAGGAATACATTAGATGCTTTGGATTGTTTCTCAGC
TAAATATTTAAACTAGTTGAAATAAAAATTCTACTACATT
GCTGTTACATATTTGCATATGTAGGCTCTTGATATTGGAT
GTGTAAATTTGACAATTCACACTGGTCTATATATTGATGC
CATTTTATAGAATTTATTTTTTGTTTATTTCTGACACTGA
GAAAGTGGGTTTGAAGTAAGAGAAATAAAAATAAATGGTA
AAATTATATTAATTAAAATAAACCTTAAAGAAAACATTCC
TTCCTATCATAAATGTAAATGTAAAAATAAAGAAACTGAA
ATAATTATAGTGATCATGTAGCTCAGAAGCATTCCAATTT
CTATGAATCAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations