Transcript

ints13-201

ID
ZDB-TSCRIPT-090929-1581
Name
ints13-201
Previous Names
  • asun-001
  • zgc:55466-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000009700 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000009700|OTTDARG00000008465|ZDB-GENE-030131-6224 asun|OTTDARP00000008362 DKEY-65M5.2-001 LG_ BX248410.4 Danio rerio protein_coding KNOWN, 2639 bp
GAATTTCACTGACGGACGCGTTTGAGTAACAGCGTTTTGT
GTCCCTTGCGCTTTTATTTTGCCTCTGCCAGTTTATCATC
AAATCAGTTTTGTTTTGTTTTATTCATAACGTCTTGACTT
AGTGTCGGTATTTGTTTTCTCTTCAGTACAACTACATGAC
AACATTTTCTATGCGAGTGAGTTTATTGAACGCGGATTCT
ACATCGATGGAAAATTAGCAGGCTGTGCTAGCAAGCTAAC
GCTAGCTGCATTTCTGGGATACACAGTGTCTGTGCTGCAG
GACCAGGATGAGGATGTTCTCAGTTTCACATAAGACGGCC
TTTGTGGTCGATCACTGCCCATACATGGCAGAGTCCAGTC
GGCAGCTGATTGAATGTGACATGCTGACCAAAAGCCGCTC
ACAGGGTGTGATTCCTCTGGCTCCAGTCGCCAAATCTCTC
TGGACGTGTGCAGTTGAGTGCTCCATGGAGTACTGCAGGA
TCCTGTATGACATTTACCCCACCAAGAAACTAGTGAACTA
CATTGTGAGTGATTCAGAGGTTCACATCCTGAACAGCTGG
AAGCAGGAGGATCAAAATACACATGATCTCATGTCTGCCT
TGGCTGCGGTTGGGCCTCCAAACCCTCGTCAGGATCCTGA
ATGCTGCAGTGTTCTGCATGGGCTGGTGGCAGCTGTGGAG
TCTCTGTGTAAGATCACAGAATATCAGCACGAGTCTCGTA
CTACTCTGATGGACATGGCTGACAGAGTGGCTAATAGGGG
GCGCATTATCTGTCTTACCAATGCCAAAAGTGACACTCAT
GTCCGGATGTTGGAGGACTGTGTGCTGGAAACCATACAGG
AACAGAACAAGCTGGCAGCAGGATCTGACAGACTGATGCC
CATTCAGCAGTGTGAGCTTGTGCTGGTCCACATCTACCCA
CAGGGGGATGACACTCTGGTCTCAGACCGGCAAAAGAAAG
AGCTTTCCTCAGTGTTAAGTAGTGAGGTTCACAGTGTGCG
AGCTGGACGGTATCTAGCCTGTAAACTGAATGTGCTGGTT
CAGCAGCACTTTGATTTGGCCTCCACCACCATCACAAACA
TCCCCATGAAGGAGGAGCAGCATGCTAACACTTCAGCAAA
TTACGACGTTGAGCTTCTGCACCATCGTGATGCACATATG
GAGTTTATTAAGAGTGGTGATCTCCACATGGCCGGCAGCA
CGAGCAGAGACAGTGGGCTGAAGGAAACAGTCACACTCAA
ATGGTGCACTCCACGCACCAACAGTGTAGAGCTGCATTAC
TGCACAGGTGCTTATCGCATTTCTCCAGTAGACGTTAACA
GCCGCCCATCATCTTGCCTCACCAACTTCCTGCTGAATGG
TCGCTCTGTGCTACTAGAACAGCCTCGGAAGTCAGGGTCA
AAGGTCATCAGTCACATGTTAAGCAGCCATGGAGGAGAAA
TCTTCCTGCATGTTCTTAACAGCACACGCTCCACATTAGA
GGATCCACCGTCCATCAGTGAGGGTTGTGGAGGACGAGTG
ACCGACTACCGAATCACTGACTTTGGTGAGTTTATGCGGG
AGAATCGACTGACTCCATTCCCAGACTCAATGGTAGATGC
AGCAGGCAGAGCTCCAATCGAGAGAGCCAAATCTCAACTA
GAACGACACACACGCTACTGGCCAATGATCATCTCCCAGA
CCACCATCTTCAACATGCAGGCGGTGGTACCATTAGCTAA
CCTCATAGTGAAGGACACTCTAACAGAAGAAGATGTGCTG
ACCTGTCAGAAGACTGTCTATAATCTTGTTGATATGGAAA
GGAAGAGTGATCCTCTGCCTATCTCAACTGTCGGCTCCAG
AGGAAAAGGACCCAAGCGTGATGAGCAGTATCGGATCATG
TGGAATGAGCTGGAGACATTGGTAAAGACTCATGTGGGCA
CCAGTGAGAGACACCAACGTGTGCTGGAGTGCATCAGCGC
TTGCCGGAGCAAACCACCCGAGGAGGAGGAGAGGAAAAAA
AGAGGAAGGAAAAGAGAGGACAAGGAGGACAAAACCGAGA
AAAATGGCAAGGACACAGAGGAGAAAAGCTGGACTGCAGA
CACTGAGAGACTAAAAGGGGTAATGGACCGAGAGAAGGAC
GAACAGAGCGAGTGTGAGATCATCAAAGATTCGCCAGACT
CACCGGAACCGCTGAACAAGAAACCACGCTTGGCTACAGA
GGAACAGCAGCCTCCGGAAAAATCCAAAGGTCCTGTCTCT
CTACTCGCCCTTTGGACCAACAGAATAACTCAAGCCAACT
CCAGGAAACATCAGGAGTTTGCAGGAAGATTGAGTTCAGT
GAATAACAAGGCCGAGCTTTATCAGCATCTGAAGGAGGAA
AACGGGATGGATGTTCATGAGAATGGAAAAGGAACAAGAT
GATGTGTGGAAAACGCTTCTTCTCATCACTGCAGGATCAT
TGATTTGTTGAGAGGATGTGATGTGACCTTTGGCATGATA
TCAAATGATGCTTTTGCCAGGATGCGGATTTTGTGCCAGA
CATAGAAGAGCAAGGCAATGTTTTATAAGGACACACTTTT
TTTATATGCTTTAGTTTGTACAAAGAGTCTGAAAGTTTGC
GAGGCAGAATAAAGAGATTGTAAATTGTGTTGTACTGTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations