Transcript

lhx4-201

ID
ZDB-TSCRIPT-090929-15681
Name
lhx4-201
Previous Names
  • lhx4-001
  • si:dkeyp-35f11.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000034994 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000034994|OTTDARG00000026384|ZDB-GENE-060728-1 lhx4|OTTDARP00000028162 DKEYP-35F11.3-001 LG_none BX294388.5,CT025732.9,CR381643.18 Danio rerio protein_coding KNOWN, 2627 bp
GACACACGGCGAAAGAACTCACGCGCGAGCGCCCGACTGT
TTCACGAGGATACGCACAGGCGCGAGGACTCTAAAAGGAC
ACTATCCGGGGAGAAAAAATATTTGATGCACATCTGAGAT
CCTCAGACCTCCGCGAGCGTGTGCATGTGCGCGTTTTATC
GGACTGGATGAAAATGATGCAAAGTGCGGCTGTGCTGCCC
GGCGAGAGCGCGGTGAAGGGTCTGCCGGACATCCTCGGAG
TGCCACTGCAACAAATCCCTCAGTGCGCAGGCTGCAGTCA
ACACATCCTGGATAAGTTCATCCTAAAGGTTCTGGATCGG
CACTGGCACTCAAAATGCCTGAAGTGCGCCGACTGCCACG
CGCTCCTGGCGGACAAATGTTTCTCTCGCGCCGGGAATGT
CTACTGCAAAGAGGACTTCTTCAAGCGTTTCGGGACAAAG
TGTGCATCGTGCCAGCAGGGGATTCCTCCTACACAGGTGG
TCCGGAAAGCTCAGGACTTTGTGTACCATCTTCACTGTTT
TGCATGTGTGATGTGCAGCAGACAGTTGGCCACTGGAGAT
GAGTTCTACCTCATGGAGGACGGCAGACTCGTGTGCAAAG
AGGACTACGAAACAGCCAAGCAGAACGATGATTCAGAAAC
AGGAGCAAAACGTCCACGCACCACCATCACAGCCAAACAG
CTGGAAACTCTCAAAAGCGCCTATAAGAACTCGCCAAAAC
CAGCAAGACACGTGCGAGAGCAACTTTCCTCAGAAACGGG
CCTGGACATGAGAGTGGTGCAGGTGTGGTTTCAGAACAGA
CGGGCAAAAGAAAAACGGCTGAAGAAAGACGCGGGCCGGC
ATCGGTGGGGTCAGTTCTACAAAAGCGTCAAACGCAACAG
AGGCTCCAGTAAAACAGAGAAGGAAAGCTCAGCCGACGAT
GCAGGACTCAGTGACAGTGAGCTCAGTTTCAGAGATGATC
AGATCCTGTCAGACTTGGGTCATGCTAACGGCCTGTACGG
AAGTGTCGGCGACGTCTCTAATGGTAACATGCTCAACGGG
AGCTTCTCTTTGGATGGAGGCGGGCAGCCTTACCATGACC
TGCGGGCAGGGAGTCCCTATGGCCTGCCTCAGTCGCCCTC
GTCCATCACTTCCCTGCCAGGCCACACTCCTCTACTCAAC
AACTTAGGCTTCAGCATGGACGGCCTCATGGGTCAGGCCG
GTCAGCCCAGTGTGGGTCAAGCTCTGAGAGCCATGGCCGG
AGGCCCCACCTCTGACCTATCCACAGGAAGCAGCACGGGA
TACCCAGACTTCCCCACCAGCCCGGCCTCATGGCTCGATG
AAATGGACCACTCTCAGTTCTGAGGTCAGACACTATGAGG
GAAAGTGCGCTACTATGGACAACATTTTATCGACGTAATT
CCCAGAACTGGCCACGATTGACAGTGTTCGGTGTGGGCAA
ACCCCCATGGAATGCCTGCACTGTATCATTTTGTAACTCG
TATTTTTTCATCGTTCTCAAAACTGGATTGGAGGATTTCC
AGCATGAGAACCCCCCAGGCCACCCTGGAAAATTAATCAC
GATCCAACGCGTTTTTGAGAACAGGAGGGTTCCATGCATG
TTTCCGAATGAGGAGGAAAATCGTCCACATTCAAAATGCC
GACGCACTTTAATGTATGTTCCTCCTCGACTGAATACTGG
AAACAGAGGAGCGCACCGAGCAAGGAGAGATATTTAAACA
AGTGGCACAAGTGTATCTTTCCTATTTACAAGGGGTTGGG
ATTTTAATGGTTGACACTTTCTAAACGGCTCTACTAGAGA
CGGTCCTTCTCGTCAACAGGCCTGAAGAACAGAAAAAGGT
TATTTTTTAATAAGGACGAATCCGCATGCACTGCTCTGAG
TTTTAAAATCTCTGTGTCAATGCTTCTTTTTGGTCATATC
CAGGAAGATAGATTGAAATTAAGGTTATTATTTATTTATT
TTTTGGTATTACCACATTGAAATGTGTTTTCGTTCCTAGT
CATTGCTCCATGAGCAAAACTTTATATATTTCAATGCATT
TGGATGTTATTTATTTCAGAGCAGATGACAGTAGTGGATT
TCCATTACACAGACACAAGTACCTTTATGGCCTGATCAGT
TATTATCAAGCAAACCAAGTGAAAGGGAAACTTACTCTGC
TATTTTCTTTCTTATTAGACACGTTTAAGCAACAACTGTG
AGGATTTCATGTTATTTATTTCTATTTTGGGTACCAGTGT
CAGTATTATGAAGGGTTGAGTTATGGGGAAGACTACAGTG
ATGTTATAAACACAAGGAGAATCATTTTCAGTTCGATACT
GCAAAATTGGACCCACACACTGGTAAAAGGGATGTTATGC
TGAAAAAGTGAACATAAGCTAATAAGAGCAACATGGAGGA
AAACAAGAAGAAAAATAACCATGTTTTTGTTGAGTCTTAA
TGGCTGTAAATTTTGTAAAGTCTCAAAAAGTGTCGACAGT
CTTGTTTCATGAGCACTATTTATTGCTATGGATCTTTGGA
AAAAAAAAAGAGCACTGAATTTAGTCCTATATGCCTTCTG
TCCAATGGTATGAATTGTGTACAGTCAAATCTATATGGAG
AAATAAAGTCGAATCGTCTTTGGGTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations