Transcript

rc3h2-202

ID
ZDB-TSCRIPT-090929-1527
Name
rc3h2-202
Previous Names
  • rc3h2-001
  • si:ch211-243g18.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000009549 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000009549|OTTDARG00000008352|ZDB-GENE-060503-694 rc3h2|OTTDARP00000008214 CH211-243G18.1-001 LG_ BX248511.4 Danio rerio protein_coding NOVEL, 2975 bp
ATGCCGGTGCAGGCAGCTCAATGGACCGAGTTTTTATCCT
GCCCTATCTGCTATAATGAGTTTGATGCCTGCAGCCACAA
GCCAATCAGCCTCGGCTGCTCGCACACCGTCTGCAAGACC
TGCCTCCACAAACTGCACCGCAAGGCCTGTCCTTTTGACC
AGACGGCTATCAGCACTGACATTGATGTGCTGCCTGTCAA
CTGTGCCCTCCTGCAGCTGGTGGGGGTGCCGGTTCCTGAG
GGAGAGGTTGTGAGTGTGGGCAATGCTGAAGACACGAGAC
ATTATGAAGTGTGCAGGATGTGTGTGGAGGAGCTGGCGCT
GTACCTCAAACCAGTCAGTGGAGGAAAAGGTGTAATGTCG
GCGAGTTCAAGTGCTCTCAGTCGGCCCATGCAGAGGAAGC
TGGTGACGCTGGTGAACTGTCAGCTGGTGGAGGAAGAGGG
CCGCGTGCGGGCGGTGCGGGCCTGCAGGTCTCTGGGTGAA
CGAACCGTCACTGAGCTCATCCTGCAGCACCAGAACCCAC
AGCAGCTCTCTGCAAACCTGTGGGCTGCAGTAAGGGCACG
CGGGTGCCAGTTCCTTGGGCCTGCCATGCAGGAGGATGCT
CTGAAGCTGGTGCTGTTGGCTCTGGAGGATGGATCTGCTC
TGTCAAGGAAGGTTCTGGTTCTGTTTGTGGTGCAGAAACT
GGAAGCGCGGTTTCCTCAGGCGTCAAAGACCAGCATAGGG
CATGTGGTTCAGCTGCTGTATCGAGCCTCCTGCTTTAAGG
TGACCAAACGTGATGAAGACTCGTCACTTATGCAGCTCAA
AGAAGAGTTTCGCACGTATGAAGCCCTGCGGCGAGAACAC
GATGCTCAGATTGTTCACATCGCGATGGAAGCAGGACTGC
GCATTTCACCTGAGCAGTGGTCATCTCTGCTGTACGGCGA
CCTCACGCACAAATCTCACATGCAGTCCATCATAGATAAG
CTTCAGTCCCCAGAATCCTTTGCGAAGAGCGTGCAGGAGC
TCACCATAATCCTGCAGAGAACAGGAGACCCAGCCAACCT
GAACAGCCTCAGAGCTCCTCTCGAGCTGCTGGCCGGCATC
GACCACAACCCTGATGCAGCTGCTCCATCTTGGCCAGAGC
TTGAGAGTGTGTTACTAGCCGTGAAGGTTGTTGTCCATGG
GCTTGTGGAGTTCATCCAAAATTTTAGCAAAAAGAGCAAT
GAAAGCCCTCAGGCTCAACCCAACAGCAAGTACAAAACAA
GTATGTGCAGGGACTTACGGCAGCAAGGCGGCTGCCCGAG
AGGAGCCAGCTGTACATTTGCCCACACGCAAGAGGAGTTG
GAGAAGCACAGAATGAGAAATAGGAAAGCTAGTGGGGCGG
TGAGGCCGTTTCTGTCAGTTCCAGCAGTGATGGCCAAATC
TTGCACCAAGGCAGGGTCAGAGGTAGGCCCCGGAGGGATA
AAGAACCATGAGAAAGATGCCTCAGAGGACGTGTCTCCAA
CTCAGCTCATCCCTAGAGGAGGAGACCAGCAGGAGGACAA
AATGCTGCTCAGTGGTGTTAACGGATTGCATGTGACCAGC
CTAGAACAGAATCTTGGCAGTCACAGCCAGTCTCCTTCCA
TATCTTCAGTGATGTCTACAGACAGACACGGGCATGTCCA
GATGAGGGCTCACCCTGAGTACTGCTCTCAGGACCAGAGA
CCATATGAGCTGACACCCTACCCTCAGTCCACCATTCCTC
CGAAGTCATGCAGTCCTCGCTTCCATCGTTCCAGCAATGT
GCCCGAGTCCATGTTACCCCCTTCAGTGGGTCCTGTGTAT
CCTGATCAGCACCCCTCTGTTCCTGCTTTAGACAGACTAG
GCCCAAGTCATTTTGGGCCGCCCTCTGCCTACTCCTCTCA
TGGCATGTACACCCCTGTTTACGACAGCCGGCGCGTGTGG
AGGCCACCGCTGTATCCCAGGGATGGAGGAAGGAGTAACT
CTCTCCCTCTAGAGGTTTTTCGATCCACTGTTTATCAGCC
ACCGCTCCGGGAGCGATACAACTCTCTAGACAGTCCATAC
TGCAGCACGACGGAGCAGAGAGCCACTATGCACAGGGCAG
GTTTTGACGCATACACTCGTGTTGATGAACTCTATCGACA
CAAACAGGAACACTGGGTACATCACCACAGCAATGTGAAC
CGGGCATCCCAGTCATCCCCAGTCTTCACTGTGGACATGT
GTCCAGAGCATCCCGAGGGTGTAGGTGGTGGGCGTATGAC
TTGCAAGTGTCATGGTGGAGAAGAGAGTCTTGCCCACTAC
TCGCCCTGGTCGTGCAGCACCATCAGCCCATTTGAGTCAG
AGCCCCATCATTTGCCAACCCACTCCTGTTCCAAACATCT
AGAAGAGGAGAGTGGTGGCAAACGGTGGTTGCATGTGTTG
GAACCATACAGACGACTGAAAGAAGAAGATCCCATTATTC
CTTTTGGAGAAGGGCCCATCATCTCCAAATGGGGAGCCAT
TTCACGCGCTTCTCGCACCGGTTTTCACACCACTGACCCG
GTCCAGGCCACAGCATCACAGGGGTGCACCGGTACCACCT
CCATCAACTTCAGAGACTATGGCTGTCATATTGGTCACAG
TGACCTTAGATGGGGCCCACGCAGTTCTGATTCCTCCACT
CACTCCAGCTTTTTAGAAAGCGATCATCTGGCAGTTTCTG
GACTGCATGCAAGACGAACTTCCTTCAGCAGTGGGACAAA
GCAGGGCTTGGATCTGATGGGGAAGGATGAGACAGAGAAT
GAAACTGACAGGGATATTGAGCTGGAGCTGTCTGCTTTGG
ACATCGAGGACACAGAGACACACGACTGCAACTCGGAGGA
CACAATGGAAATGCAAAGCCGCTCCCAAAGCAGCCACCTC
TCTACAGTCTTTAGTGATCCAGCATCCAGTTCACAGTTAG
AAAATGACCTGCCTGACAGAATGGATGCTAACCTTATGAA
AAAAATGGCATTCAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations