Transcript

krt97-201

ID
ZDB-TSCRIPT-090929-15021
Name
krt97-201
Previous Names
  • krt97-001
  • zgc:92061-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000034121 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000034121|OTTDARG00000025829|ZDB-GENE-040718-78 krt97|OTTDARP00000027531 CH73-78I5.4-001 LG_ CU041376.9 Danio rerio protein_coding KNOWN, 1503 bp
AAAACTATTACGCAGCTGTCTGAGTTGTCCAACAAGGCGC
AGAGGCAACAGAAACCATGTCTCAGGTTACTCAGTCTTTC
TCCCGCAAGAGCGTCTCCAGCTCTCGTCCGTTCTCTTCAC
AGTCTCTGACTGGTGGATACTCGAAGCGCATCGCCGTCGG
TCGCGCTCCAAGCGTTTACGCAGGTGCTGGAGGCAGCGTG
CGCGTCTCTTACGCACAGAGCTCCAGGGGCGGTTTCGACA
TGTCCAGCGCTCTTGCCGGGGGCGACAATGGCTTCGGCAT
GGTTGTCAACGAGAAGACCACTATGCAAAACCTCAACGAC
CGTCTGGCCAGTTACCTGGAGAAGGTGCGCTCCCTGGAGA
AAGCCAACGCGGAGCTGGAGCGCCAGATCCGGGAGTGGTA
CGATAAGAGGACCCCAGTTTCCAGAGACTACAGCCACTAT
TATGTCACCATTGAAGATCTGCGCAAGAAAATCTCCGTTG
CCAGCCAGGACAATGCCAGAATCATCCTTCAGATTGACAA
TGCCAAACTGGCAGCTGAGGACTTCAGAGTCAAGTATGAG
AATGAATTGGCTCTGCGTCTGTCAGTGGAGGCCGATATTG
CTGGCCTGAGGAAGGTTCTGGACGATCTCACCATGACTCG
CTCTGATCTTGAGATGCAGATCGAAGGTCTGAAGGAGGAA
CTCGTGTACCTGAAGAAGAACCATGCAGAGGAACTCGCAG
CTCTTCGCGCTCAAATGACTTCCAGCAGTGTAAATGTAGA
GGTTGACGCTGCACCTCAGCAAGACCTGGCCCGCATCATG
GAGGAGATGCGACAGCAGTATGAAGGCATCACAGAGAAAA
ACAAGCGTGAAATGGAGGCCTGGTACAAGGGCAAATTCGA
CGAACTGAACAAGCAAGTATCCACCAGACAAGAAGACCTC
TCAATGTCACGTAATGAAATCAACGAACTCAGGAGAACAT
TGCAGGCTCTGGAGATCGAACTACAGTCACAGCTTAGCCT
GAAATCAGCTCTGGAGGGCACACTGGGAGAGACAGAGTCA
CGGTACAGCATTCAGCTCAACCAACTGCAGGCCGTCATTA
ATAGTCTGGAGCAGGAGCTCACTCAGATGCGCATGGACAT
CGAAAGACAGGCCAGCGAATACAAACTGCTGCTGGACATC
AAGACCAGACTAGAGATGGAGATCGCAGAGTACAGGAGAC
TTCTGGATGGAGAGGATATTCAGAGACAGACAATCAAAGT
AGTCGAGGTTGTAGCACCCCCCAAGCCCGATCCTGTTGTG
ACCAAGCGCGTTCGCACAGTAATCGAAGAGGTGGTTGATG
GTAAAGTGGTCTCTCGCACAGAAGATGTCGACGTCGAGGT
CATGAAGAAGTAAAAATGGTGCCAAATGAGACCCATTAAG
TCGTCATTAATTTTCGGCCCAAACGAATTATCAAATTAAA
TTATCATTGTTCAACACCTCATGTGAAAATCTAAGACAAA
TAAAAAGACGCTGCGAAATCAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations