header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-14984
Transcript Name: si:rp71-68n21.9-201
Previous Name: si:rp71-68n21.9-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034081 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034081|OTTDARG00000025809|ZDB-GENE-081105-100 si:rp71-68n21.9|OTTDARP00000028959 RP71-68N21.9-002 LG_ BX511129.15 Danio rerio protein_coding NOVEL, 338 bp
CAGCGTGATGCTTAGTGCTATAATGAGAAGACACTTTTGA
AACCCCCAGATAAAGCGCCTCGTCTTGAAATCAAACAGCA
AAGAAGTAGATACCAAAGACATGGGTGGTGAGGAAGGAAA
GCTGCATCGAAGACTTTCACGAATAGGAAGCAGATCGCAG
AGAGAGCCGCCACGACCCCCTCCTCAAACAGAAAAGCCCC
CAGCAGCGGTTCCTCCAAGACCTGCTGAGGCCACTCCAAA
ACCTCCAGAACCAGCACCAAAACCAGTTGTAATCCCTCCA
AAACCCACAGTGCCACAAAAACCTGTTGCCCCTCCAAAGC
CTCAAATACAAGTGTTCA

si:rp71-68n21.9 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA si:rp71-68n21.9-201 338
si:rp71-68n21.9-202 (1)    Ensembl 2212
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:rp71-68n21.9-201 Contained in:
[BAC] RP71-68N21 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000034081 (1),  Ensembl_Trans:ENSDART00000142985 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CD600912 (1) 347 bp
CITATIONS (2)