ZFIN ID: ZDB-TSCRIPT-090929-14978
Transcript Name: si:rp71-68n21.12-202
Previous Name: si:rp71-68n21.12-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034073 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034073|OTTDARG00000025804|ZDB-GENE-081105-169 si:rp71-68n21.12|OTTDARP00000027502 RP71-68N21.12-001 LG_ BX511129.15 Danio rerio protein_coding NOVEL, 1520 bp
AATCGCAGGAGCTTCAATTGGAGTGGCTGGAAGACGCTCC
TGCTGCCGCAGCTCAACAGACGCTCACTGTTTGTCTACGG
CAGTGAGGTGGCGGTGGAGAAGGAGTGTATCAGACAGAAA
GAGGGAGGTGTGTTGGTCATCCACCCCTTCAGCCGATTAA
GGAGTTACTATATTATGTGCATGGTGGCCATAACATTTCT
CAATCTAATTGGGATTCCAATGGAGATTGCCTTTCTGGAT
GGAAACAGTGGAGTAGGTTGGGAGGGTTTTAACGTGTTCT
CAGACACCCTGTTCTTGATTGATGTAGGGGTGAATTTTCG
CATGGGAATCATTCCTGAGGACTGTGAGAGAGCCATACTG
GATTTGAAAAGCATCCGTCACCGGTATTTAAAGAGCTGGT
TTATACCTGATTTGGTGGCAGCTTTCCCAGTTGGCTACAT
ACTTCTTATTGCGGATCTACAATACCACAGTGACTCTCCT
TCATCGAAAGCCAGCAAAATGATGCGCATCCTAATGTTTG
TGCGAATCATTAGCCTTGTCCGTCTGCTGCGAGTGTCAAG
GCTGGTTAGGTTTTTCAACGAGGTTGAGAGAGTTTCAAAT
GCCAACTTGGAGGTGGTGAGGGTATTCCTGAAAATCTTGT
CGTTGTTTATGATGATTTTCCTGCTGTGCCACTGGAATGG
CTGTATTCAGTATTTCGTGCCTATGCTTGAGGAATTTCCC
TCAGACTGCTGGGTCAGAAGAGAGAATCTGATGAATGCCT
CAGTGGGAGAGAAGTACTCTTTTGGAGTTTTTCGGGCGCT
CTCTCATATGACTGCAATATCATACGGTTCTTCTGAAACA
CCTACAAATGATGTTGAGCTGTGGATTGTCATGACCAGCA
TTATGTCTGGAGCCCTCATGTATACGGTGATGGTAGCAAA
CACGGCTGCAATGATGACTGATGTGGATTTAACAGCAAGA
GCCTACAAGAACAAGATGAATCACCTGGAAGATTATATGA
CCTTCATGAAGCTTCCCAAAGCCCTTCGTATGCGTATCAA
CAACTATTATCAGTCTCGTTATGCAGGGAAATGGTACGAT
GAGAAAGACGTCTTAAAGTGGGTGTCCTCGTCTCTCAGAG
AGGAAATTCTGATAACCATGTGTTCGGCCCTTGTGAGGAA
AATCCCCATTTTGCGTAACTGTGATATAAACTTCATCAAC
GGGCTTCTTGTGGAGCTGCAATACGAGGTTTACCAGGAGG
GAGACATCATCATCCGAGAGGACACCGCTGGAGAGCGGAT
GTTCTTCATCGAGCATGGACAGGTCCTAGAGGAGAACGAG
TTTTACCAGAGGGAACTGAGCGACGGAGATTACTTCGGAG
ACTCATGTCTCCTAAGAAGAGGAAGGCGTTTGGCCACAGT
ACAAGCTCAGACCACCTGTCAGCTCTTTTCCTTGTCGCTG
GACAGTTTTTATAAAGTTTTGGAGGACTATCCAGACATCA
AGAGGGACCTGGAGAAATCTCAACAGGAAAAAGACCTTTT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:rp71-68n21.12-202 Contained in:
[BAC] RP71-68N21 (1)

Genome Resources: Vega_Trans:OTTDART00000034073 (1),  Ensembl_Trans:ENSDART00000131586 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)