ZFIN ID: ZDB-TSCRIPT-090929-14975
Transcript Name: si:rp71-68n21.11-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000034070 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000034070|OTTDARG00000025803|ZDB-GENE-081104-488 si:rp71-68n21.11|no_translation RP71-68N21.11-002 LG_ BX511129.15 Danio rerio processed_transcript NOVEL, 790 bp
CATGATATATTTGGTACATGCAGTAACAGATGATTTTTAC
TTGAAAATGTTTAAATGTAACTTTTACTTGATTGTCGTTT
TCGATCTGCGTTTTAGGCTTACAAAAGATAGAATACAAGG
AATCACGGCGCTACTTTTGTCAGTCCAAGTAACTTAGACT
TGCAAAAGAACAACAATCGACGCAAGTGTTTCAGTCCAGC
CATGCACAAGTAACACAAGTGACGGGGCCATGCTAATCTT
CTCTGTATCGTTCCAATTTTAGTATATGTGCTGCCGAAGC
AAGCACGAGCTGGGAGTCTGGAGGACGGCTATATATACCA
GTGACTTCTGGGCATGCGCAGATCCCCCCTGCCTTGGATA
AGAGCACAAAACACTCCGACAAAAGGAAGCTGCTCTCACT
AGAGCAGAGCCCATGAAAACCCAGACAGACACGTGGAGGG
TAAGAATACTCTAAATCTTGGAGACATGAAAAACTGAGTT
CACAGCCGGCGTTGAACTCAAAGCTCTCAGCAGAACAAAG
ATCAAACATTCAAACTGACGTCGAGAACAAAGCCTGCCTG
TCATGCAGCTACATGTGCTATGTAGCATTCTCCTGGATAT
CGTAGTTGTGAAATTTGTTTTTATGTTTTAAAAAGGACTA
TAAAAGTCATTAGTTGCACAGAGATTAGTTTGTTATGTCT
TAACTATAGCTTCATAGAATCTTGCTAATAATCTGACTTT
AAGTTTTTGCTTACAGCATTTATCCACAAAGCTTAAATGG
ATAGTTTACAGGAAAATAAAAGTGGCTCAG

si:rp71-68n21.11 TRANSCRIPTS
Type Name Length (nt) Analysis
ncRNA si:rp71-68n21.11-001 (1) 687
si:rp71-68n21.11-002 790
si:rp71-68n21.11-003 (1) 657
si:rp71-68n21.11-004 (1) 711
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:rp71-68n21.11-002 Contained in:
[BAC] RP71-68N21 (1)

Genome Resources: Vega_Trans:OTTDART00000034070 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CO916503 (1) 789 bp
CITATIONS (1)