Transcript

appb-203

ID
ZDB-TSCRIPT-090929-14931
Name
appb-203
Previous Names
  • appb-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000034023 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000034023|OTTDARG00000025772|ZDB-GENE-020220-1 appb|OTTDARP00000027472 appb-002 LG_ CR759841.8 Danio rerio protein_coding KNOWN, 2256 bp
ATGGGTATGGACCGCACGGTATTCCTGCTGTTAATGCTGA
CGACTTTGTCCCTCGCCATCGAGGTGCCGTCGGATGACTC
GGTGGGCTTGTTGGCGGAGCCTCAGGTGGCCATGTTCTGT
GGGAAACTCAACATGCATATCAACGTCCAGAGTGGCAAGT
GGGAGCCTGATCCAACTGGCACCAAGAGCTGCATCAGCAC
CAAAGAGGGCATCCTTCAATACTGCCAAGAGGTATACCCA
GACCTCCAGATCACTAATGTAGTGGAGGCCAACCAGCCTG
TCAGCATCCAGAACTGGTGCAAAATGGGTCGCCGCCAGTG
CCGCAGTCACACGCACATTGTTGTTCCCTACCGTTGCCTG
GTTGGGGAGTTTGTCAGCGATGCCCTCCTCGTCCCAGATA
AGTGCAAGTTCTTGCACCAGGAGCGAATGGACATGTGCGA
GAGTCATCTACACTGGCATACAGTGGCCAAAGAGTCCTGT
GGTGATCGCTCCATGAATCTGCATGATTATGGTATGCTGT
TGCCGTGTGGAATCGACCGTTTCCGGGGCGTGGAGTTTGT
GTGCTGCCCAATGGAGGAGCAGAAAGACTTGGACAGTGAG
GAGCAGGAGGAGGCTAACTCTGACGTGTGGTGGGGCGGTG
CTGAGACTGAGTACACTGATGCCAGCGTGCTGAAAGAACA
GGTCACAGCCAAGCCTGATCCTGCAGTGACTGAGGATGAT
GAGGATCTCAACAATGAGGAAGATCAAGTCTGGGACAACG
ATGAAGACGGTGACGGTGAAGATGATGAAGATGAGGAGGA
CGATGATGAAGATATAATCGATGAGCAAGACACCAGTGAA
CAGACCTCCAACATTGCAATGACGACCACCACCACAACCA
CAACAGAGTCCATAGAGGAGGTTGTGCGAGCGGTGTGCTG
GGCCCCTGCTCGGTCAGGGCCGTGCCATGCCAAGCTGCCC
CGCTGGTATTTTGTGGCAGAGAAGGGCCGATGCGCCTCCT
TCACCTTTGGGGGTTGCGGGGGAAACCGCAATAACTTTGA
GTCAGAGGAGTACTGCATGGCTGTCTGCAGCAGCAGTGTG
TTGCCAACCATGGCCCCGAGCCCTGCTGATGCGGTGGATC
GTTACCTGGAAGCTCCAGGAGATATAAACGAACACATGCG
CTTCCAGAAGGCAAAGGAGAGCCTGGAGGCCAAACACCGA
GAGAAAATGTCAGAGGTGATGAGGGAATGGGAGGAGGCCG
AGAGACAGGCCAAGAACCTTCCTCGTGCTGATAAGAAGAC
CATAATTCAGCGCTTCCAGGAGAAGGTGGAGTCGCTGGAG
AAGGAAGCGGCTGGAGAGAGACAGCAGCTGGTGGAAACGC
ACATGGCTCGAGTGGAGGCCCTACTGAATGACCGCCGCCG
TCAGGCTCTGGAAAGCTACCTGAGCTCCCTTCAGTCTGAC
CAGCCTCGGCCTCGGCAGGTGCTGAATCTGTTGAAGAAGT
ATATCCGTGCGGAGCAGAAGGACCGTCAGCACACTCTCAA
ACACTTTGAACACGTGCGGGAGGTCGATCCCAAGAAGGCT
TCACAGATTCGGCCATTTGTGATGACCCACCTACGTGTGA
TTGAGGAACGCATGAACCAGTCTTTGGGTTACCTCTATAA
AGTGCCTCAAGTGGCTAATGATATCCAGGATCAAGTGGCG
GTGCTGGTTCAGCGTGATCAGGCTGAGGTGACGCAGCAGC
TGTCGTCTCTTCAGAGTAAGATGAGGGTCAGTTATGGGAA
CGATGCCCTGATGCCGGATCTGCCCGACAGCACCACACCA
CTGGACAACCTTCCTCCAGAGCAGGACGGCCTGGGCTTCA
TCCATCCCGAGAGCTTTAACCAGGCCAACACTGATAACCA
CGTTGAACCTGTAGATGCCCGTCCAATTCCCGAAAGGGGT
TTGCCTACGAGACCCGAGATTCCAAAGGTTCGGCTGGACA
TTGAGGAAAGGCACAACGCTGGCTATGATGTTCGTGACAA
GAGACTGATGTTCCTCGCGGAGGACATGGGCTCTAATAAG
GGTGCGATCATTGGGCTGATGGTGGGGGGCGTGGTCATCG
CCACTGTCATCGTAATCACTCTGGTTATGCTCAGGAAGAA
GCAGTACACCTCTATTCATCATGGAGTTATTGAGGTGGAT
GCGGCAGTGACTCCTGAAGAACGTCATCTGGCAAAGATGC
AGCAGAATGGCTATGAAAACCCCACCTACAAGTTCTTTGA
GCAAATGCAGAACTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations