Transcript

sytl5-202

ID
ZDB-TSCRIPT-090929-14767
Name
sytl5-202
Previous Names
  • sytl5-001
  • ottdart00000033832
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000033832 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000033832|OTTDARG00000025677|ZDB-GENE-070912-424 sytl5|OTTDARP00000027357 DKEY-19H21.5-001 LG_none BX571713.11,BX571845.6 Danio rerio protein_coding NOVEL, 1110 bp
TCTTCCACTCCTGCCTCGGAGAGAAAGTGGGGTTTCCTTA
ATGTACCAGATTCAGATGCTGACACTACCAGCATCAACAG
TCTGATGAGTGTGTACAGTGAGACGGGGGACTATGGCAGT
GTTCGGGTTTCGGGGGAGATCCTGCTCAACATCTCTTACA
GCTATAAAACAGGGGCTCTCAACGTGCTCGTCCGCGAGTG
CCGCTGCCTAGCAACCGGAGATGAGAGGAGACAGCGCACG
GATGCCTATGTTAAAACCTATCTGCTGCCAGACAAGTCCC
GTCAAAGCAAGCGCAAAACCAGCATCAAAAGCAACAGCAC
AAACCCAGTGTTCAATGAGAACCTGAGGTACGTGGTCAGT
CACTCTCAGCTGGAGACGCGGACGCTGCAGGTCTCAGTCT
GGCATCATGATCGTTTTGGACACAACAACTTCCTGGGGGA
AACAGAGCTCACCTTTGACTCCTGGGAGTTTGACACGCAG
ATAGAAGAATGGTTTGCTCTGCAGCCTAGAATTGAGTCTG
ATTATGTGGACTCAGTGATGCACTATAAAGGTGAACTGAC
GGTGGTTTTGAAGTACATTCCTGCAGAGAGAAACGTCTCT
CTGCCTCTGGACCAAGTACAAGTGAAAAAGGGATTTCTTA
AAGGAAAGAAGAAGACCATCACTCTTCCTAAAGGAGGAAT
GGTGGAGCTGCTGGTCAAAGAGGCAAAAAACCTGACAGCC
GTCAAAGGAGGCTCTTCTGACCCATTCGTCAAAGGATATC
TGCTTCCGGATGACAAGAAGAGCACAAAGCACAAGACGGC
GGTGGTGAAGCGCAGTGTAAACCCACGCTGGAATCACACG
TTCACCTACTGCGGCCTGCAGCACAGTGATCTGGACAGTG
TGTGTCTGGAGCTAACCGTATGGGACAGAGAGCCCTTCGC
CAGCAATGTCTTCCTCGGTGGAGTAAGGCTCGGCGCCGGG
ACAGGTCTGAGTTATGGGAAGGAAGTGGACTGGAACGATG
CCTACGGGGAGGAGCAGCGGCTCTGGCAGCGCATGATTGA
CAACCCTGAGGTTCCTCAAGAGTGCACACTGATGCTGAGA
TCCAGCATGGCCAGGAGGAAGACGGACTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations