Transcript

slc39a10-201

ID
ZDB-TSCRIPT-090929-14679
Name
slc39a10-201
Previous Names
  • slc39a10-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000033736 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000033736|OTTDARG00000025625|ZDB-GENE-040426-1157 slc39a10|OTTDARP00000027298 slc39a10-001 LG_ CR936498.13 Danio rerio protein_coding KNOWN, 5196 bp
GCAGTGGGCTCTGAGTTTTGTGCGGTGCGCAGCGTGAGTG
TTTTAGTACCGAGCGGAGAGGAGATGCACACGGCACTCGA
GTGAGAGGTGTCTAAGAGAGGAGATGATGAGAGTTCACAC
ACATACCAGATTGTGCTTTCTCTGTGTGCTGACCCTACTG
TACCATCAGTGCAGCCACTGCCATGAAGGAGGGTCCCACC
ATCACCACGGGCACAACCACGGAGACCACGACCACATCCA
CAGTGACCTGCAGATTTCAGAAATGTCCTGCAATGGTTTA
TCAGATCGGCTGGTGCACGGCAGTCAGGGTGAACCTGCGG
AGAACGAGCAGCGTTACTACATCCACCAGCTGTTCTGTCG
ATACGGCCAGAAGGATCGGCTGGATTTCAAAGGCTTCCAG
AGTTTGCTGCTGAGTTTAGGGCTGGGTGAAGTGCGGGTGG
TTGGGTTGGAGCATGAGGATCTGGGCCACGATCATGTGGC
ACACTTAGATATTCTGGAGGTTCAGGACGGTCGGCACTCG
CACTCAGCTGGCCATCCGCACTCTCATCAGAATCCCAACA
TCTCACACAAGACCCACCAACACTCTCACCATGAGAATGA
GGAACACACTCTTGCTGAGGATGTGCCATGCAGCAAGACA
CTTGGCACCGGAGCCACCCCACCCAGTGTATCTGAGGAAC
ACGATCATGATCATGAACATGACCATGATCACGACAAAGA
CAGTGATCATGAACACAACCATAGACATGTCACAGACAGT
CCACAGACTCAAGATCACGAGCATGACCACATACATTTGC
ACACACACAGTCACAAGCAAGACAGTGATGTGACACAGCG
ACTGGAACTCGATCATGATCAAAAGAGTAGAGAACATGCA
CAAGAACATAATGATCTAAGTGACCAAAACCACCATCATC
ATGACCACCATCACCACAAGCACCCCCACCCTCATCTCCA
TGCTCCAGAGAGCGTGGTGCACACCACCTCAGCAATGCCG
AAAATTCAGCCTTCTGTACCGCCTGAGCTGCCTGCCAACC
AAACAAGAAGACACAGGAGGCCATCTAAGGTCAAAGCCCA
TCGAGGCCGCAATAGGACCAGCGTCACTGTTACACAAGCT
GTTGAGCTGGAGACCAGCGGGGATGACCATGAGCACAGTC
TCCAGGATCACAGCCCTGCTCAGCAGCAGAGAGGCAGGAG
AGAAGTGCCAGGATCACCTGCACATGGTGTTCTTCACCAA
CATGAAGAGTGTCTAAATTTAACACAGCTGCTTCACCAGT
ACGGCCTGAGCTCAGATTCTCTCATCTCTCCAGTGCAGTT
CACCTATTTGTGTCCAGCTCTGCTCTATCAGATAGACAGA
CGCTTCTGCATCCTTCATTACCACCACGTTGAAGCAGAGG
AACAAGTTGCACCATCTTCAGGATGGGTTTGGATGTGGGG
CTTTGTGTCCATCACCATCATCAGTCTGCTGTCTCTGCTG
GGTGTTGTTCTGGTGCCCATTCTCAATCAGTCCTGCTTTA
AGTTCCTCTTGACATTCCTGGTGGCTCTGGCTGTGGGAAC
TCTCAGTGGTGATGCCTTACTGCATCTCCTTCCTCACTCT
CAAGGGGACCATGATCATAACCACGGGGAACAAATGGAGG
AAGAGCCGGAGGTGGATTTTCTTATAAAGTTTGATGGGGT
TTGGAAAGGACTGACTGCACTAGCAGGAATCTACCTCCTC
TTCATTATTGAACATTGCATTGGCATGTTCAAACACTACA
GCGACCAAAGGGGAGGCCTCTGCCATAAGAAGAAGAAAGG
AGAGCAGGCAAAGATCGGAAGGAAACTGTCAGACCACAAA
CTCAACAGGCGTTCAGATGCTGAGTGGCTCCACCTGAAGC
CTTTAACAGAGGGAGATGGTACGACATGTGAAGCAGGACA
CAATGACACTCAGATGACAGAATTGCAGCCTCTGGATTCA
CCCAGCAAGATGCCACTGAATATCTCTGATTCAGATCACC
CTTACGAAGCGCCAGTAAAAACAGAAGAGGACAATGTGCC
AAAAGCCAAGTCAAAAAAGCATGGGCATGGGCACGGACAT
GGACATGGGCATGGGCATGGTCATTCCCACCACGGGCATT
GCCACTCAGACCAAGAAATGAAAGATGCAGGAATCGCCAG
TATAGCATGGATGGTCATCATGGGAGATGGCATGCATAAC
TTCAGTGATGGACTCGCTATAGGTGCTGCTTTCAGTGCTA
ATATTACGGGTGGAATTAGTACTTCAGTAGCGGTGTTCTG
TCATGAACTGCCTCATGAACTAGGTGACTTTGCTGTTTTA
CTGAAGGCTGGGATGTCTGTGAAACAAGCCATTGTGTACA
ATCTCCTCTCTGCCCTGATGGCTTATGCTGGCATGGTGAT
CGGCACAGCTGTGGGACAGTACACACACAACGTCACCAGC
TGGATCTTTGCTGTTACTGCTGGCATGTTTCTCTATGTGG
CATTAGTGGATATGTTGCCAGAAATGCTTCACGGTGACAG
TGAGGAGCACAAGCGCTGTGAAATGGGCCACTTTGTCCTG
CAAAACTTTGGCATGCTCACCGGGTTCGGCATCATGCTGC
TCATCGCCATCTTCGAGGATCACATTGTGCTCGATTTTGG
CTTCTAGCTGGAGGCCGAGGTCTTTGGGGGACCATCATTC
ATCGGCTACATTCACACACGTGCTTTGCCTTAAAGTGGCT
TTGTTTTGTGACGGTACAGTCTCGCAGGCATGTCTTAAAA
GACAGCATCAGTAGCTTACAGCGGACATGCAAACAAACAT
GTTTACATTTTATCATCTCTCGTCTCTTCCTCTCTAGGCC
ACTCAAAACGGTTGCTTGAGCGCTCTCGCATTTCCTGTTT
TGTTATTTTGAGAATACGTGTCCAACAAGGCAATCCACAG
CACACAAGAAGCACTCCCCAGTTTTTTGGGTTATCCCTTT
AATATATTATAGTTGTTTTTTTGTTTTATTTTTTAGGACG
GTGTCCTAGAGAGAAGCAGCTATTCATCAGTCACTCATCA
TGTTGTGTTTGCTGTTTCAGATTGTAACTCATAGTTTGTT
CATTCGTAACTGGTGTTGTGCTGTGTATGTCTAGTGTGTC
ACACCATCAACTTGTCGGGCGCAAAAATGGTGCAACAAAG
TCCAACTGGCAACAACTTTGCTGACTTTTTGTTGTTTGTA
AATTATTGAGAAGTACTGGTCAGTACTGGTTGTGTGCCAC
CATTCTGAGAAACAACACATACTTTTGATGCTGTATAAAG
GGATGGTTCACTCAAAAATACTAATTTACTCTCCCTTTAT
TTGTTCTAAAGTTTTATGAGTTTCTGTTGAACACTAAAGA
CGATATTCTGAAGAAATCTGAAAACCTGAAACCATTGACT
TTCATGTTAGGAATACAAATATTACGCAAGTCAATGGTTA
CAGCTTTCTTCAGAGTATCTTCTTTTGTGTTCAACAGAAA
AAGAAAGGTTTGCTTAAATTTTTAGCCTTGGATGAGCTGT
CCCTTTAATGAGCTCTTTTTTTACTGGTTTACACTTTGTT
GGTAGTATTGACTTGCTTGCTTCGAACACTATATTTACTG
TTCATAGTGATGGGAGAGTCCTCAGTCTTAGAATTTTGTT
TGTTTTTATTTTCTGTTATTATTGGCTAAGATTGTAGCGT
TTTGGCCAGCTTTGCATATTTGAAGGTATGCGACTGTGTT
TTGACTAACTTCTGACACAGTGCTGCCAAAAAGCCGATCA
CATACAGGAGGTCAGGAGAACAGAGACTGAACAAGTCCAG
TATTAAAGCTAATGCGAAAGCACTGTGATTTATTCTTTTT
TTTCTTAAATGAAAAACAACTAACATATCTGTATATCAAA
GAATACATCAGTTTTTCTTTGGGAAGTCTATTTGTTCATT
GATAAAATAGAAATGATCATGATTTAGACTACTTTCCGAA
TCTAAAAAGTTGATTCATATCCAAGTTGTGTTGTGATAAA
TAGTGATCTCGTTACTGTTCCATCATGAGATAATTATGTT
CCCCAAAGGAAATTTGCTACTGAAAACGTTTATTTTTTTT
TTAAACATGCTAGTATTTTGAAACGCCTTTGTTACTTATT
ATTTTTATTTTAATTATAAAACATGTTTGATATTGCTGGA
GTTTTCTTTGCTAAATTCTAAATACATTATTTTGTGAGAC
ATCAGCACCTTTTATAAACTGACCATCTAAAAACTTATTT
TCCATACAAAGTTTGGGAGAACCAATACATTTTTATAACT
TAAAACTGTTCGCCATTATGAAATGTTCTTTTTGACAATC
TTAAATATTCATTTTTGACACCCTTGCATTATTGAAATGA
TTTCAGGCTGTAATTATTGGCCTTCCGTGCACCTGTATGA
AAGTATGAATGCAATCAAATGTCTAGAAGATCTGTTAAAT
TGTCCCCCTGTTGATGCGAGCGTGCATCATTTTGGTTGTG
CCAAATATGGGCTGTTTCTGAACTGAACTGCCATTGCCTG
CAGTCGCCTCTATACATTCCACTTGCTGTGTTCGCTGCTT
GAATCCTCTGCCGTCATGAGTTGGTGGAGCATGTTATGTG
ATTCATGCTTATCCTGTCACCATGTGACATCCATTTATTT
TTTTTCTTGTGGGCGTGTGTCTTATTAATTACATTCATCA
AATGTATTTGATTGGATGGAAACGTGCATGAGACAAGTGG
AAGAACAAAATGTCTCATTTCTGTTATGAAATGAAGAGTT
GACAACACGTACTGTTGATTTTCCTCTTACCCTGAAGTAC
TTAATTTTTACAGCTTGAATGTAAAACCAATGATTTTGAA
GGTCATGTGAGCAAACGTAATCACAGTCTAATTAGGTTTT
CTCCTTAATATGTGTTTGTGAAACGAAGTTGTTAAACTGT
ATTTGAGGAACAAGAGCTCCAAAGCTCAAAATGAAATACC
TTGGTTACATGGTGCAAAAATGACCTCAATAAAAAAGTGA
CGCCAGTTTTCATCAGGCTTTACAGTGTATTTCAAGAAAA
GGACCATCCAGTTATTTACTTGCATTGTATTGTCAATTTT
GGCAGATTTTTTCCCAACCCATTTGGATGTTGAAGCATTT
TCAGTACATTTGTCATTCTTGCTGATTGTCTGTGCATTTC
TTTGTCAGAAGTGGAAAATAAAGTTTGCAAAGCCTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations