Community Action Needed: Please respond to the NIH RFI
Transcript

crha-201

ID
ZDB-TSCRIPT-090929-14203
Name
crha-201
Previous Names
  • crha-001
  • si:dkey-146p10.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000033069 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000033069|OTTDARG00000025132|ZDB-GENE-070912-371 crha|OTTDARP00000026743 DKEY-146P10.1-001 LG_ CT574558.4 Danio rerio protein_coding NOVEL, 690 bp
AGACAGCAGACTCTCACCGACAATTGGTTTCTGGAGGACA
CCGACTGAGATTACCGTGAATTCCCCTATGAATCTGCACG
TGGTTGTCGTTGCGGTGTCCCTCGGACTCTCCGTCTGGAG
CTCTGACTGCGCTCCTGGACACACGGACGCGCCGCTGCCG
GTCCTGATGCGCGTAGGGGAGGAGTACCGGATACGCCTGG
ACAACAGCCCGAGCGCGCTCGACCGGAAAGCTCCGTCGCG
CATTCAGCTGCAACTCACACAGCGGCTGTCTGGAGGTCAG
ATCGGTGGTGTCGGTAACGGGATCCTGAGCAGCCCAGAGG
ACCGCGAGCGTCGATCGGAGGATCCGCCGATCTCGCTTGA
TCTGACGTTTCACCTGCTGCGTGAGGTGCTGCAGATGGCG
AGAGCCGAGAAAATGACCCAGCGCGTAACCCACAACCGCA
AGATCATGGACGATTTAGGAAAATGAAGCATTAATAACTC
ACAAAATAGTTGTGTCAGCGTTCAGTGTAAAAAAGAAATA
AGTATTACCACTTTAAGTCTACACTTTAAAAAACATAGGC
TACTTCACATTACATTCACTCTAAGAAATGCTGGGTTATT
TAAACCCAAACTGAGTGAAATATGGACAAACCCAAACATT
GGGTTAAATAGGCCTAAATTTGATCCTATATTTAAAAAAT
GAACACATCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations