Transcript

cbx8b-201

ID
ZDB-TSCRIPT-090929-14138
Name
cbx8b-201
Previous Names
  • cbx8b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000032965 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000032965|OTTDARG00000025067|ZDB-GENE-050522-325 cbx8b|OTTDARP00000026663 cbx8b-001 LG_ CR854963.9 Danio rerio protein_coding KNOWN, 1660 bp
TTATGGGCTGTGTGCAATTCTGAAGCTAGAGCAGTAGGCG
GACAGAGCTTGCGCTCAGCTAGCTTCGCTGCAAGCTAACG
GTAGAAGGAAAACATGGAGCTGTCGGCTGTCGGGGAGAGG
GTGTTTGCTGCTGAATCGATCATCAAGAGACGAATACGCC
GGGGTCACATGGAATATCTCGTGAAATGGAAGGGTTGGTC
ACCTAAGTACAGTACTTGGGAACCAGAGGAAAATATCCTA
GACCCGCGTCTTTTCGTCGCATTTGAAGAGAGGGAGCGTG
AGCGAGAAATATTTGGTCCCAAGAAACGAGGGCCAAAACT
CAAGACTTTTCTCCTAAAGGCCCAAGCTAAAGAAAAGGCA
AAGTCGTATGAATTTAGGAATGACTCAACTAGAGGCATTC
ATGTTACATATTCCAGTCCAGAGCCTGTAGTAGCCCCTAG
AGCGAGAGAGGGCCTTCGCGCTGTGGTTCCCACCATTTTC
CCTCCCAGCACAGTCAACCGTGGTGAGAGTGTAAGGCTTC
AGTCCCCAGAACCAAGAGAGCATCATTCGCCACACTCACC
AAGACCCACAGATGAATTTAGCCTTACCCCAAAAAAGAGA
GGACGGAAGCCCAAATTACGCTTCACAGATGGGTATATAA
GCAATTTGCATCCAGAGCATGTAAAACGGGCAGCAGATGA
AACCATGGCAAGCATTCCTTCTAAAATGGCTAAGTTAGGT
TTGGGGGAAGATGATGAGAGATGCCCTGACATAAGTGGGA
GACTTAAAATATCTCACAAGGACTTGGATGCTACCTGTTC
ACACAAACAAAGCAACGTCATTCCAAGCAGGAGTACCCTG
CACATTTCTCCACAGTGGAGTTTGCATTCCAGCAGAATGG
AGGCAGGCTTACTGGGCCACAGGACTAATCCACAATCAAA
CCACTTTCACCAGAAACACCTAAAGCACTATTCAAAAAAA
AGAACACTTGAACATGGTGATTCCACCAGCAGACAGCCTT
CACTTATTGCCAAAATCCCAGTGTCGCATATATTCAGAGA
GCCTGGGGTGGAAGATGCTTGGAGACCCTCCTTCATAAAT
GTGGAGAAAGTTATAGTTACTGATGTGACCACAAACTTCC
TGACTGTAACAATCAAAGAGAGTAATACAGATGAAGGCTT
CTTCAAAGACAAAACATGATTTATATTTTCCATCTTCATA
CAAGTCATTTTTGTTATAAATATTCCACATTGTGTATGAA
ACTTTTTCTGTCACACTGAAATCTGTATTTATTGTGAAAC
TGCTGCTTTAAGAGGAGTGCATGCAGTAGACATGTCCAAC
AAAGCTAAAACTGCATTCAAAAACACAGGAGTTCTCATTT
GTTGTAAATATGTTTTAATTAGTTTATTGTCTCTATATTG
CCCATTATAGTCAATGTCTACAATAATATTAAAACTACCA
TACATTGGCATTTTTCACAACTAGCCTCACAATATTACCT
CTTGTCATTATGTGAAATGTAAAGTAAATTTCTTTGGAAT
TTTATCACTTATATCAGCTTATATTGTCAGTTACCTTGTA
TGCTTGTTCCATGGTACAACAAACTTAATATGCATATTAA
AAAGTGTCAAATGAAATTCAAATTTTCAAATCAAACTAAA
AAGTAAACCACAGTAATTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations