Transcript

cdh7-002

ID
ZDB-TSCRIPT-090929-14073
Name
cdh7-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000032745 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000032745|OTTDARG00000024955|ZDB-GENE-061019-3 cdh7|no_translation cdh7-002 LG_ BX511023.8 Danio rerio protein_coding KNOWN, 624 bp
ACAGCATCCTTGAGGGACAACCATACTTCTCTGTGGAACC
AAAAACAGGAATTGTGCGGACAGCTCTGCCCAACATGGAC
CGAGAAGCACGGGACCAATATCTTCTAGTAATCCAGGCCA
AAGACATGGTTGGCCAGATGGGAGGACTCTCAGGAACTAC
GTCGGTGACGGTCACTCTGACGGACGTTAATGACAACCCT
CCCCGCTTTTCACGGAGTATGATTCTACTACCAGCTATAA
AGCAGTCGCAGACCCGATCCATCATTAACGCATGCTGTCT
CTCCTTTTAAATTGCAAGCAAACTATCTGAGCTGTTTAAT
GACTCAGGCTGATCTTGTATTATAGAGATCAAGCGCTCTG
TGTAGTCGCTGCGTAATTATCAGGTAGATGATCTTCCGAA
TAGAACTGAACAATCTTCATTTTATAATAGAGGATTTTTT
TTTTAAGATCATTGCCAGAGTTCTATTTTTAGCTGTGTGA
ATCTCTCCCCGCCATCAGGGAGTGTGTGAAGCTTAGACTA
TCCCCTTGCTTGCTATATCTATAGAGTGGCTTACCTGCTA
CGGAGCAGAGATACATTATTAGCTCAGACCTGGTGCTAAC
AGCTGGGTGATAAGAAAGGAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations