Transcript

creb3l2-202

ID
ZDB-TSCRIPT-090929-13952
Name
creb3l2-202
Previous Names
  • creb3l2-001
  • zgc:158603-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000032575 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000032575|OTTDARG00000024854|ZDB-GENE-070112-1542 creb3l2|OTTDARP00000026371 CH211-258F14.7-001 LG_ BX546489.13 Danio rerio protein_coding KNOWN, 319 bp
TTCCCCGCCCCCAAATTCCTGCTCGTCTGTGAAGGGGCGA
CATTTCTCAAGGAAGCCGAGAGGAAAGTTCCGTGAACATT
GGCGACAGACGCTCAACTTATGATCAACTTTTAGCTGACT
GTAAATTAGTCTTTCTGAATCGCGGTCTGGCGAGTAATTT
GACGGATACGCTGATAAACAGCCGTTTCTGGGGTCGTTGA
AGCGACGCTGCGCCTCCGTGACGATGGAAATAATGGATAG
CGGAGAGCCGTTTTTACAATGGGACAAAAATCTCAGCGAA
TTGTCAGAAGCCGGTGAAAATGACATTTTATACAGCACT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations