Community Action Needed: Please respond to the NIH RFI
Transcript

grin3ba-201

ID
ZDB-TSCRIPT-090929-13722
Name
grin3ba-201
Previous Names
  • grin3b-001
  • grin3ba-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000032187 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000032187|OTTDARG00000024579|ZDB-GENE-070912-354 grin3ba|OTTDARP00000026116 DKEY-119N4.1-001 LG_none CR392012.7,CT954241.10 Danio rerio protein_coding NOVEL, 4090 bp
ACCGTGGCTGCATCCGCGCGCGCGTAAAACCATTAAGGAC
AAGAACAACTGGACAAAAATAGAGCGATGCCATCTTGTGA
CGAAACCTCAATCCAGTTGCGAAAGGAGCAGGATGAATTT
AGTGCTCTTCAGATTCTTGGCATACCTTCACGTTGGGCTC
CAGGTCGCTCTCCAGATGTTTATTTACCCTTGTCATCTGC
ATCCCCAGCCCTGTCACATCCTGGCACGCATTGGGCACAC
CGTGCGCTTGGGTGCGCTCCTGCCGACCCGCCAGCAGTCC
AGGATACAGGGCGCCCTCAACCGCGCCCTGGTCCACCTCC
GGCAAAGTGGGAACAACTTCTTGCCCTACAACCTGAGCTT
GGAAGTATTGTCCCGAGAACCGCTCAATGGAGACCCGGAG
TCCATGTTCAGGTGCGTGTGCCAGGATATCGTTGTTCAGG
GAGTCTCGGCTGTGCTCGCGTTCCCCCAGAGCCACGAGGA
GCTCATACAAGTGGAGTTCATGTCCTCGTTTTTGGAAATA
CCCTTCATCAGCATCATTGAACAGGGTGAACCTCTTAAGA
CACAGAACCGCTTCCATTTGCAGATGATGACTCGAATGCC
TCCTTCAGGGCTCTCGGACCTGCTTTTGGCTGTGTTGCTG
AGGGGGGGCTGGCAGGGTGGAGCGGCAACTGTCTGTCCGG
GAGGTGGGAATACTGGAATGCTGGAAGAGCTTCAACAGCG
TGGTCACCTAGGTTTAGACGGAGCCCACTGGCACCTTTGG
GAGACTCTCAATCTGTCCAGACTTGAGGAAAATATAAGCG
AAGACAAGGTAATGGAGCTCCTATCGCAGCTCCTCAGCAG
GACTCCTTCTGCTCCAGCGTCCTCCGTGGTGCTTTTCGGC
TCCGACCCTGAATGTACAGCCACAGTGCTGCACTGTGCCC
ATCAGTTGAGTGGCACATTGCCCCCTATGCACTGGATCAT
GGGATACCCGCTTAGTCTGGATTCTCTACACTCTATTGGC
TCCCCGCTTGGTCTTATGGCTTATGGGGAGGTCAATCGCA
AACCCTTGAACTTCTACATTAGGGACACCCTGCAGCTCAT
TGGCAGAGCTGTATATGCTGCTACCATGGTGAGACCAGAT
TTGGCACTCATTCAAAACATGGTAAACTGTTTCGACAAGC
CCAATAAACATGAGCTACCCTCCTCCGGACAGTACCTTGC
CAGGTTCTTGTCGAACACTTCCTTCACTGGGCTGACAGGC
CCTGTGCGAGTAGAGCGCTCTTTCTCCAGAGTCCTTACCT
CCCAACGCTTTCACATTTGGAGTCTCCAGCGGGATCCTCT
AGGCCAGCCAAGTTGGGTGACCGTGGCAAGCTGGCAGTCG
GGCCGACTGGAACTGGAGGAACAGGGCCTGTGGCCAGGAG
TGACCCAGCACCAGCGGGAGGATGGCCCAGGGATCAGACT
TGGCGGACGCTGGCAAGCAGGACTCCCAGTGGCAGGGAGC
AGATTGCGGGTTGTAACCTTAGTCGAGCACCCGTTTGTGT
TCACAAGAGAAGTGGATGAGGAGGGCCAATGTCCGGCAGG
GCAGCTGTGCCTTGACCCTCAAACCAACAACTCAGAAGTC
CTCAACCAGCTGTTCAGAGAGCTGGAGCAAACCAACAGCA
GCTCCCTGCCAACTGACATGCGGAAATGCTGCTACGGATA
CTGCATTGACCTGTTGGAGAAGTTAGCTGAGGACATGCAC
TTCGAGTTCGACCTTTACATTGTAGGCGATGGGAAGTACG
GAGCATGGAAAGGGGGTCGATGGTCTGGGCTGGTGGGTGA
CCTGCTCAGTGGTGTGGCGGATATGGCTGTCACCAGCTTT
AGCATCAACTCAGCTCGAAGCCGAGTGATAGACTTCACTA
GCCCCTTTTTCTCCACCAGTTTGGGGATCCTGGTGCGAAG
CAAGGACACAGCTGCACCCATTGGTGCCTTCATGTGGCCC
CTTCACTGGTCCATGTGGGTGGGCATCTTTGTGGCACTGC
ATATTACAGCGCTTTTCATCACTCTATATGAGTGGAACAG
TCCCTTCGGCATGACTCCACATGGACGCAATCGCATTAGG
GTCTTCTCATACTCGTCTGCTCTTAACCTCTGCTACGCCA
TCCTGTTCGGCCGGACTGTCGCCAGTAAGACTCCAAAGTG
CTGGACAGGCCGCTTCCTCATGAATCTTTGGGCCATATTT
TGCCTCCTGGTGCTGTCAAGTTACACAGCCAACCTAGCAG
CTGTCATGGTGGGGGAGAAGACCTTTGAGGAAGTGTCAGG
AATTCATGATGTCAAGCTCCATCACCCATCCCTGGGGTTT
CGCTTCGGCACAGTGCGTGAGAGCAGTGCTGAGGACTATG
TGAAAAAGAGCTTCCCCGAGATGCACGAGTACATGAGGCG
CTTCAACAAGCCCACCACTCCGGATGGAGTCTCTACACTC
AAGACAGATCCCCCTCAGCTTGACGCCTTCATCATGGATA
AAGCTTTGCTGGACTACGAGGTATCCATAGACGCAGACTG
CAAACTCCTGACTGTAGGAAAACCGTTTGCTATTGAAGGT
TACGGGATCGGTCTGCCCCAGAACTCCCCTCTCACACGCA
ACGTCTCCGAGTACGTCAGCCGCTACAAGTCTGACGGTTA
CATGGACATGCTTCACGACAAGTGGTATAAAGTGGTTCCC
TGTGGCAAGAGGGTTTTTGCTGTGACAGAGACTCTGCAGA
TGGGCATCCAGCATTTCTCTGGGCTGTTCGTGTTACTGTG
TGTCGGGGTAGCAGGAGCTTTACTCACACTTCTGGGGGAA
CACGCTTTCTTCAGATTCATCCTGCCTCACCTCCGTCACC
AGCAGAGGTTCAAATACTGGCTCCACACCAGCCAGAAAAT
CCACCGTGCAATAAATATGGGTTGTGATGATGAAAGGAAG
TCAGAGGCTGAGAGCAGTGACAGATGTCCCACCTTGTGCC
TGTCAGAGAACTGTAATCTCCACCGCCTGCCGCCCTCGTC
CTCTTCTCCGCCTTCCACCTCCTCCACGTCCACCACTACA
ACCAAGTGGAACAATCAGAGCGTCAAGGCTGGTCGAGAGG
CCAAAGAGCAGAACAAGCGTGTCCACTTCAACCTGGAGAC
TCTCAACAGCTACCAGCTCCAAGCTCCGCCTCATGGGGCG
GAAAGGGGGCGAAGAGGGTTGGTGGGAAGCCCACCTACCC
AATTGTGTTCCAACGGTGGCCCGAATCCCAGTCTCAGCCT
GGTGCTTTCACCCCTGACCTGCTCAGGACACTCAACGCCA
TGGGAAGAGGAGCTGCACGAGCTTCAGGGAAGGATCGAGG
AGTTTCGTGGCCAGCTCAGGGCAGCTCTGGCTAGGCGAGC
CGAGCTCCAGAGGACCCTAGTCAGACAGCGGCTCAGTCAG
TCCCAAAACAGCTCCTCATATAATCCCAACACCAACACCC
TGACCAAAGACATCAACAGGGGGAGGTGATGTTCGCTGAG
TGTCGGCAGTGGATATAAGGGGATAAGGGACATCCTCTCA
TCTGAGAAGTCGTGCCGTGCTATTTTCTGCCTTCTTCTTT
TTTTCAATGACTGCTGGAGTGCTGCAGTGATGGATGAAAC
ACTCTGTGATGGAGATTCGCCTTGTAATCCTGCAGTCTGG
CTCATTTCCAGCTTGAGAGAAAGCATTTATCTTTGTGTGT
ATGTGTGTGTGTGCGCGTGTGTGTGTGTTTAAAGCCAGAC
AAGTGGACAGAGAACAGACACTTAATGCACCATTCACTGC
TGGCCAAGGTGAATATCTGCACCCACAGACGTCTGGCATG
ACAATTGCTTCATTTTGTAAATAAGTCAATGGGATTATTT
AGAGGGATAAGTAACACTGGACCAGGTCTCAACCTCGGAC
CACCCATGGTCCACTCACTGACCGTCGGATTCACATTGCA
CACTAAAATCAGTTCTTAAATAAGAATTAGCAAATGTTTT
ACAACTTTCAGGATTTTCAGGATTTCCTTTTCTTTTTTAT
ATTCGACTTAATCAAGGTATAAAGAATGTTTTCAGTTCAG
GGTTTAGTTTGAGGCCATGTTTACACCTGGTATTAAAGGG
ATAGTTTCCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations