header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-13640
Transcript Name: agtr1a-201
Previous Names: agtr1-001, agtr1a-001, si:dkey-4m11.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000032066 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000032066|OTTDARG00000024486|ZDB-GENE-070912-546 agtr1a|OTTDARP00000026028 DKEY-4M11.2-001 LG_ CR788256.3 Danio rerio protein_coding NOVEL, 1077 bp
ATGGACAACGTCACTTCCGACTCCAACACGGGACTTGCCC
TCGCCTGTAACATGACAGGACACCACAGTTTCATCTTCAC
CTTCATCCCAGTTGTCTACAGCTTCAACTTCATCATCGGA
CTCATAGGCAACAGTCTGGTAGTCGCCGTCATCTACTTCT
GCTTAAAACTGAAGACAGTAGCCAACATATTTGTCTTCAA
TCTAGCCGTTTCAGACCTTACATTCCTCCTCACCCTTCCC
ATCTGGGCCATTTCCACTGCAACAGGCTACCATTGGCTTT
TCGGAGACCTCCTATGTAAAACAATAGCTGGTATGGCTCT
CCTAAATCTATATACTAGTATTTTTCTTCTCACTGCTCTC
AGCGTTGACAGATATTTGGCTATCGTTCATCCTGTCCAGT
CTAGACGCTGCCGTACGGTGATCTATGCCCGGGTAACATG
CGTTCTAGTTTGGGTGGTATCATTTGGCCTAAGCTTGCCC
ACAGCCATCATCCGTGGGACCCATTTCATCCAGGACAACA
ATGTTACCGTATGCGCCATTCACCACAAAGAAGACATTCG
TAATGTCCTTGCAGCTCTCAGTCTGATGAAGAGCGTTTTT
GGCTTTCTTCTGCCTATCACCGTCATCCTCACGTGCTACT
GCCTAATTGGTCGGGCTCTGCCTAAAGCAAGGGACATTCA
GAGAAATGCCAGGTCAAACGGGGATGAGGTCTTGAACATG
TTGGCTGCTGCCGCCCTGTCCTTTTTCCTTTGCTGGGCTC
CCCATCAGATCTTCAACTTCATGGAGATGCTTCTCCTGCT
GAAAGTCATCACTAGCTGTGACGTTGTGGACATCATTGAT
ACTGGGATGCCATTCACCATTTGCATTGCCTTTTTCAACA
GCTGCATGAATCCAATATTGTACAGTTTTGTTGGAAAGAA
CTTCCGGAGGAACTTGTTGAAGCTCTTAAGGTGCTCCTCG
ACGTCCGTGGCCTCTCATCCAGCCCTCAGCACTAAGATGA
GCTCACTTTCATATCGAACTTCAGAGTTATCGCACCTCTC
TGTCATTAAAACCCCTTCACTCCCTCGGGCCACATGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
agtr1a-201 Contained in:
[BAC] DKEY-4M11 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000032066 (1),  Ensembl_Trans:ENSDART00000021528 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)