Transcript

stag1a-202

ID
ZDB-TSCRIPT-090929-13626
Name
stag1a-202
Previous Names
  • stag1-001
  • stag1a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000032052 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000032052|OTTDARG00000024478|ZDB-GENE-070912-448 stag1a|OTTDARP00000026019 DKEY-223D7.4-001 LG_ CR786576.5 Danio rerio protein_coding NOVEL, 7677 bp
CACCAGATGGCGGTTTAGGATTGCTGCTCTTCTGAAAGGC
GCGGTTCCATCTCCTGGTCCAAATTTCAATTAATAAATCC
ATATTTAGCAAAAGTTTTATCGAATTCCAAATAGCGGGAA
CGCCGACCTTTACGACCATGAGCATCCCAGGCTCAGAGTC
GCCATGTTAAAATTGTGATCTCCTTTTAAAGCACACTGAA
GACCCATCCCAACAGAGCAGACACACTTCAGACCTGTAAC
ACAACATCTAACCCTCCGTCATCATGATCACCTCAGAGCT
GCCGGTGCTACAGGACACTGGTGATTCAGGTCAGGACACA
GTGAGTCTCAGTATGAGCATGAGTGAGCTGGATGACCCTG
GAGACGGAAAGATCAAGAAGAAGAGAGGAAGACCTGGCAG
ACCACCAGCAGCCAACAAGAAGCCTCGGAAGTCTCCATCA
GAAAAGGGCTTTATGGCAGTCCAGAGGGGGAGAAAGGCCA
ATGGCATCAGCCAGCAGAATGGAGAGGGAGATCCTGTTAC
TCTGTTTGAAGTGGTCAAACAGGGAAAGAGTGCTATGCAG
TCTGTGGTTGATGACTGGATCGAGTCGTATAAGCAGGACA
GAGATCTAGCACTTCTGGACCTCATCAACTTCTTCATCCA
GTGCTCTGGCTGTAAAGGCACTGTAAGAATCGAAATGTTT
CGCAATATGCAGAATGCTGAAATCATCCGCAAAATGACAG
AAGAGTTTGATGAGGACAGTGGCGATTACCCTTTGACCAT
TTCTGGCCCTCTGTGGAAGAAGTTTCGCTACAACTTCTGT
GAGTTCATCTGTGTACTGATCCGCCAGTGCCAGTACAGCA
TCATCTATGATGAATACATGATGGACACAGTCATCTCTCT
GCTCACGGGCCTGTCAGACTCACAGGTCCGAGCCTTCAGA
CACACCAGCACTCTCGCAGCCATGAAGCTGATGACAGCTC
TGGTGAACGTGGCTCTGAACCTGAGCATTAACCAGGACAA
CACACAGAGACAGTACGAAGCTGAACGCAGCAAAATAGTG
GGAAAGAGAGCCACTGAGAAGCTGGAGCTCTTGCTTCAAA
AGAGGAAAGAGCTTCAAGAAAACCAAGATGAAATCGAAAA
CATGATGAACTCCATTTTCAAGGGAATCTTTGTTCATCGC
TATAGGGATGCAATAGCTGAAATCAGAGCCATTTGTATAG
AGGAGATCGGTGTATGGATGAAAATGTACAGTGATGCCTT
CTTGAACGACAGCTACCTGAAGTATGTGGGCTGGACCTTA
CATGACCGGCAAGGTGAAGTGCGCTTGAAGTGTTTGAAAG
CCTTACAAAACCTTTACACAAACCGTGAACTGTTTCCAAA
ACTTGAGCTCTTCACAAACCGCTTCAAGGACCGTATCGTG
TCCATGACGCTGGATAAAGAGTATGATGTTGCTGTGGAGG
CCATCAGACTGGTCACGCTCATCCTGCAGGGTAGTGAGGA
TGCTCTGTCTAATGAAGACTGTGAGAATGTGTATCATCTG
GTGTATTCAGCTCACAGGCCTGTAGCAGTGGCTGCTGGGG
AGTTTCTACATCGGAAGTTGTTCAGCAGACATGATCCTCA
GGCAGAGGAAGCTCTAGCCAAGCGCAGAGGCAGGAGCAGC
CCAAACGGAAACCTAATCCGCATGCTGGTGCTTTTCTTTT
TGGAGAGTGAGCTGCATGAACATGCTGCCTATCTAGTGGA
CAGTTTGTGGGAGAGCTCTCAGGAGCTGCTGAAGGACTGG
GAGTGCATGACTGAACTGCTACTGGAGGAGCCAGTGCAGG
GAGAGGAGGTGTTGGCAGACAGACAGGAGAGTTCTCTGAT
TGAACTGACTGTATGTACCATTCGTCAGGCTGCAGAGGCC
CATCCGCCAGTGGGGAGAGGAACTGGAAAAAGGGTCTTGA
CTGCGAAAGAAAGGAAGATGCAGATTGATGACAAAAACAA
ATTAACAGAGCATTTCATCATGGCTCTCCCCATGCTGCTC
TCAAAATACCAGACAGATTCAGAGAAAGTAGCCAATCTTC
TGCAGATCCCACAGTACTTTGACCTGGACGTGTACAGCGC
TGGGAGAATGGAGAAGCACTTGGACGCATTGCTAAAGCAG
ATCAAGTTTGTAGTGGAGAAGCACACGGACACAGAAGTGC
TGGAGGCCTGCAGTAAAACATACAGCATCTTGTGCAGTGA
AGAATACACCATTATGAACCGCGTGGACATTGCCCGCAGT
CAGCTGATCGATGAACTAGCCGACCGTTTCAACCACTCGG
TGGAGGAGCTGCTGCAAGCGGGGGAAGAGGCAGATGATGA
CGACATTTACAATGTTCTCTCCACTCTGAAGAGACTTACA
GCCTTTCACAATGCTCATGATTTGACCAGATGGGATTTTT
TTGGAAACTGCTACAGATTGCTAAGAACAGGAATAGAGCA
GGGCTCCATGCCTGAGCAGATAGCAGTGCAGGCTCTTCAG
TGTTCTCATTACTCCATACTCTGGCAGCTGGTGAAGATAA
CTGAGGGAGCTCCATCCAAGGATGATCTCCTAGCACTACG
TAGGGTTGTCAAGTCTTTTCTAGCTATATGCCAGCAGTGT
CTATCAAATGTCAACACGCCGGTAAAAGAGCAGGCATTCA
TGCTGCTCTGTGACCTGCTGATGATCTTCAGTCACCAGCT
TACCACAGGCTCCAGAGAGGGTTTGCAGCCGCTAGTCTTC
ATCCCAGACGGCACGCTGCAGAACGAGCTCCTAAACTTCA
TTCTTGATCATGTGTTTATAGATCAAGATGATGAGAACCA
GAGCATAGAGGGTGATGAAGAGGATGAAGCAAACAAGATT
GAGGCCTTACACAAGAGGAGGAACCTTCTAGCTGCCTTCA
GCAAACTCATCATTTATGACATCATAGACATGCCTGCTGC
TGCAGACATCTTCAAACACTACATGAAGTACTACAACGAT
TATGGCGACATCATCAAGGAGACTTTAAGTAAGACCAGAC
AGACGGACAAGATACTGTGTGCCAAAACACTCATCTTGAG
TTTACAACAGCTCTTTAATGAGCTGATCCAGGATCAGGGG
CCTAACTTGGACAGGACCTCGTCTCATGTGAGCGGCATTA
AGGAACTGGCCCGTCGCTTTGCCCTCACCTTCGGATTAGA
CCAGATCAAGACCAGAGAGGCTGTAGCTACACTGCACAAA
GATGGGATTGAGTTTGCCTTCAAGTACCAGAATCCAAAAG
GAGCAGAGTATCCTCCTCCCAATCTGGCCTTCCTTGAGGT
TCTCTGTGAATTTTCTTCCAAGCTTCTTCGTCAAGACAAG
AAAACAGTACATGCATATCTGGAGAAGTTCATGACGGAGC
AGATGATGGAGCGGCGGGAGGACATCTGGCTTCCACTCAT
CTCCTACAGGAACTCTCTGCTGACGGGTGGAGATGAAGAT
CGCATGTCCATCACCAGCGGCAGCAGCAGTAGCAAAGCTG
GATCCATACGCAGCAAGAAGGGCCGACCGCCACTGCACAA
GAAACGCATTGAGGAGGAGAGCATGGAGGGCTCTTGGATG
ATGAGGAATGACAGCATTCAGACCCCTGGAGGCCTGCAGA
CGCCACAGCTCACCTCAACTGTGCTCCGCGAAAACCCTCG
ACAAGCTGCTGAACACCTGCCTGAGCAGGACACTGAGCCC
GGCTCAGAGTCGGACTATGTTCATAATCCTCAGATGCAGA
TGTCGTGGCTCGGCCAGCAGAAGATGGAGGAGGTGAACAG
GAAGGAGCGGACGGCCATGAGCTACATAAAGGCCCGCAGT
GGAGGAGTGCGACAGACTGTACGTGGGCTAATGGAGGACG
ACGCAGAGCCCATCTTTGAGGACGTCATGATGTCGTCTCG
AGGACAGCTGGAGGACATGAGTGAGGAGTTTGAGGACACC
ATGGTCATCGATCTGCCTCCATCCAGGAACCGGCGAGAGA
GAGCAGAACTCAGACCAGACTTCTTTGACTCTGCAGCCAT
GATTGAGGATGAGTCGGTAAGAATCAGGATCTTTGGTTTA
AAGATTTTAAGATGACCAAAACAACATTTCAGATCCATTA
TAATGCAGTCGGTCCACTGGTTTGTCCATTGATACCATCT
CATTGCACCCATTTTTGTTCAAACATGACTTTTTCTGATA
CTGGAACTTAGTAAATTTGTTTCCATGGTTGTTTGTGAAC
ATTTTTTCTTAGCAAATAAAAAGGGGATCCTACTCAGTTG
TGCGTTTACTTTTTTTTTAATGCACAATTTCAAAGTTTAC
GCACATCTTGGCTTTTCCATTAAGCATTTTTATGCGATAC
ACCAGAATGTGCATAAAAATGAATGGATAGACACATTGTT
AGTGGGAATTAGTCAAATAGATTCATAATCATCAAATTTT
TCAGCCCTGCTAACAAGAAGCTTTCCAAAACTCTCCTCTC
AAATCACATTCATCTGATAAATCATAGTTGGGTTTTAATC
GAGAATTAAATGCAGCTACAAGTTCCTAAAAGTGAATCAC
CTGTAATTGTTTTTGTTTTTTTTTCTCAGGGATTCACGAT
GCCCATGTTCTGAGGTGCCACAACAAATGGAAGAGAGGAG
CATTTGGTTTGATTAAAGCAAGGGCTGAAGAGACATTCAC
AAAGAGGAGGAAGCACTGATGTCCAGGTTCAGTGACTCTG
GATTAAACTCTCCACAAACTCTCAATTATCCTCTTTCATC
AAGCACCACATCAAAGGAGTTTTTTCCCCACCCAGATGCA
GTCCCATCAAGTCACGTATGGTAAAATGTTCCGTCTTCAT
CAGCTTATCTGAATGGCACTGAATGGGATTTACGTCGTGG
TACAGATTTATGATGTAAGAATGTACGCTCCCATATGTTT
AAGATGTACATATTTGTGTTTATCCATCCTACTATGTAGA
AGCCCTGTACAGTTAGATTATGAAGTCGTCGCTTTAACTA
TGTCCAACAAAACCACCAGTAGTAAATGTCGATCGATCTT
CAGATGGTCTAAATTTACACAACGCCCAGTAGTATTCAAT
AGCCATAATTCTGGTTAAGTGTGTTACGTTTGGTAAGTGT
TGGGGCCTGTTCACACCACAGATGATAATTATGATGATAA
TAATAAATATAAGGGTTTAAAAATAGTTAAGCATAAGACA
ATAGCAGGCACGTCACATCAGCTGTTATGAATATAGAAGA
CAAACAATATTGTTGTAATTGCCTCAAAGCTATTTTATTC
TAGCAAGTGAGGGATTAAAACAGAGATTGATACAGGTTTT
ATGAAGAGCAATTTACTACTTTTTAGAAGACAAATTAAAG
AATATTGTATATTAAATCCGAAGGGAACGCAGTATGTTCT
CCGAGGTATGTATCAGCTGTATTAGCAACACTTCATATAA
AAAAACACTACTATGTACAGATCTGTTACTTTTGAATTTT
TTTTTTTACATACTGACGTGACGTTGTGGACCGAGGCTTT
GAAGCATGTATCAAAAACATTATACATCTCGCAGTGAAGC
AGTGTATCGAAGCTTGATTCGTTTTGCCATAATCATGTGA
TCAGTGGTGTCCGAAACTTCATTTTCACCTATACCCAGGT
TTATGCTTCGAATTTTAATTCAAAAGTATTAACACCCTCG
TGGGTTAGTAAAGTGTATAGCGAGAGATTAGGCACCGATT
ACATACATTTCTACTGTTTCAAAGCACTGCAGTTATTCAA
CTAAAATACAATAGTAATTTATAGTAAAAAGCTTTTGGAC
AATACTAAAGTGTATTATTTACAACTATTTTTAAAGAAGG
CCACTGCATATTGTAGTATAGTAGTAGCAGTCTATAAGCA
TCACTCTGACAGCCTCCTCCTTACAGCATTGGCCTCCCAT
ACAGGAATCGCCGGTTCGATCTCCCTTGGGAATGAGTTAA
TGTTAACATGATAAACATAAATACTTTTGAATACCTTGGA
TTTAAATACAGTCATCTGTGGTGTAATGTAAATAACTTAT
ATGTAAAAAAAAAACTATAGTATCTGAGTAATTTGTTTAT
ACTACTGTTGTATTACACGTGAATGAGTTGGTCAGTTGTG
AACATTTGACATTTTTGCAACACAGTGCTTTCCCAAACTT
TAACCAGCAGAGGTCCTCGTCGAGCTCTGATTTAGAAAGC
TTCGAGTTACAAATCTTTTTCCGAGTCGAATGGTTCACTG
GTTTAGAAAGCTTCAGTTCACATCACTATTTTTACATATA
AAGACTAACTCTGATTCTATACACTAAAAAAGGAAATGAC
TTTTACCATGTTTTTATTAAGTATTTTTGACACGTTTCCA
TTAAAAATGTCTACATGTAAAGATTCTTGTCATTTTTTCC
AGTAAAACTGATTAATGAAATGGTTAAAATAAGACACATA
TCTGTTAGTAAGCTTAGAAAATCAACTAAATTTCATTAAC
AGATATGTGTTCTTATTGTAACCATTTCATTAATCAGTTT
TACTGGAAGCAAGACTTTTAGGCTTTTAACAGCATTTATT
TATTTTTTTGTTCCCATGAAAATGTCTTGATTTAAGAAAC
TTTAGACATATTTCTTTAAAATTTAAAGTATTTGTATTTG
TAACTATTATTGATAAACTATTAATTTTTTTAGGGCCTTA
AATTTAGAAATGGCAAAATTGTGACTTTCTAAAATCCATA
AAAGAAAACTATTTCCAACAAAAATGGTGTCGGCTCTTAT
AAAGCAGTTTAAAGTTTACATTGCTTTGCTGAAACACGCA
AGTTAATAGACAAAACGTTATCATGAATCAGTTGCTGGGT
TTTCATCACCCTGTATTATTTTGAAGTATCTTGAGAAACA
ATGATGGAAACGGCACATTTTAAATAAAAATCGCTTAATT
CACAAAATCAATTGATATGGTTTTTGGACTGCAGAAAACA
AGGTTTAATACGGATAATGGGAGATGGAAACACATTTGCC
GAATATACACTAATCAGCCGGCTCCATTATGCTTGGCTTG
TTTACCACTGGTTACTGGGTCACCAACACTACTACAGTCA
GCTGCTCTAACAACTAGATGGAAACACTATATTTGCAAAC
TTTAAAAAGATTTATTCATGGACACTACTATATTTTTATT
GTTATCTTCATAGTTGTGGTTCGTGGTGTGAACAGGCCTT
TAAAAATGCAGTGATTATTGTCAGAAATGAGATAGAGAGC
CAAAAATCTCAATGACACAATTGTCCCGAAGGTGCGTTCC
ATTACATGTTGTGTAATTTTGGCTTGCAGAAACATTTGAA
TGGTCAGTATTTGATTTCCAGTAGATTTAGTTCTAATAAG
GTGAGGTTTATTTGTGTGAAACGTCTAAACAGCAGGGTGT
TTTTGTGTGGATCAAACTGCAGAGGCCCGTTTCAGTGCTC
TATGGTCCTGTGCTCTTCAAAAGTGAAACGTTACACCGTC
GACAACACAAGTTTCCCATGATGCTCTTGACTTCCCATCC
CGAGCCTCGCTTAGTTTTGCTAGTGTTCCTGTAAATTGTA
CATTTTCAATATGAAATGGGTTTTCTTTTTGTACAACCTA
GAAATGATGTACCACTTTCCCTTTTAATGGAAAACTGTTC
TAAAACTTTTCTTCGGTGAACTTATGGACGACTCACTTTT
TCAGAAAAAGACAAAAAATTAAATGTGTAATCATGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations