Transcript

kcnh2a-201

ID
ZDB-TSCRIPT-090929-13593
Name
kcnh2a-201
Previous Names
  • kcnh2-001
  • kcnh2a-001
  • kcnh2l-001
  • ottdart00000032019
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000032019 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000032019|OTTDARG00000024460|ZDB-GENE-070912-699 kcnh2a|OTTDARP00000025996 kcnh2l-001 LG_none CR788285.5,BX000358.11 Danio rerio protein_coding NOVEL, 4532 bp
AAACACAGAGAGGGGCTGTTTCGCAGCGCGTCGGAGAAAG
TGATTGAGTGAACTGGGACAGAAAGTTGATTTGCATCCAT
TTGCAAACAAAAAGGGAAGCAGGTGACGTGAGGTAATTGG
AGAGACGGCTGATTTACTGAGCTCGAGGATGCGCGCACTG
ACAGATTTAACACGTAATCACTGGAGACTTTGAAGAGACG
CGCTCTCGTGCTGCTTTTACATCGATGTGGTGTGAAGGTA
AAGCTTGTGTACATGTGTAACACTTCGCGGTAGAGTCGAT
ATATCGCTCTTATTCAAGTAAATACAAGCTGTCGAGGAAC
TTGCAGAACTTTCTTGCCCTGCTGTGGTAGGACAACATGC
CTGTACGACGGGGACACGTTGCGCCTCAGAACACCTTTCT
GGACACCATCATTCGCAAATTCGAGGGTCAAAATCGCAAA
TTCATCATCGCCAATGCTCGAGTTGAAAACTGTGCCATCA
TCTTCTGTAATGATGGCTTTTGTGGGATGTGTGGCTACAC
GCGTTCAGAGGTCATGCAGAAACCGTGTACATGCAGTTTT
CTGTATGGCCCACACACTGGACGACCAGCGGTGGCCCAGA
TGGCCAAAGCCTTACTGGGCTCTGAAGAAAGGAAGGTGGA
GATCTCCTTATACAGGAAAGATGGTGTGTGTTTGCCTTGC
CTTGTGGACGTGGTTCCTGTTAAGAACGAGGACGGTTTAG
TTATCATGTTTATCCTGAACTTTGAGCTGGCAGATCAGCA
GGACAGACCCCTCGACAGCTCACCAGGCAGAGACATCAAC
AACAAAAACCCCATTCCGTGGCTCTCTAAAGCAAGACGAC
GTCGTCTCCGGCTGCCACTGCCCTTGCTGCACTCTCTGAG
TGGCAGTAAACAGTCTCTGCATGAAGACACTGAAAAAGGC
TTCATGCAGCCGATGCCTCATATGGGCCATGAGTCAGTAG
CCCTGGACAAACTGCTCTCCCTACCTGAACGCTCAGCACT
CGGAGGATCTCAGCTGTTGTTCTGGGAAGATAAGGCTCAG
ACTGAGTCTGAAAGTGAGCTGCGGCCATCAGAAGTGTCTC
CTCCTCTGCCTCAGGGCTTCTCGCAGTCCTCCCCACGTCT
GCACAACCTCACCTCAGAGGCGTCTCCGTCCAGTTGCAGC
ATGGCCCACAGCCGCTCCTGTGAGAGCCTGTGTGGCATGA
GGCCCTCACCCTCCACCAATGACTTTAACTGGGACAGAAA
ACTGCCAGTCAGACCCAGTAGCACAGGTGCCATGCACCGC
AAAGCCAGCTTACAGAATGCTACTTCTGACTCAGATCTCA
TTCGGCTCCGGAGCTCAGGTCGGGGCACCCAAATATCACA
CAACTTAATAGATATGAAGCCGGACGCATTAATTGCAGTC
CCCACCGGTGAGATTGACATCATCGCCCCCTGCAAGCTGA
TCGACCGGACCCATAATGTGACAGAGAAGGTCACTCAGGT
TCTGTCTCTGGGTGCAGATGTCCTTCCTGAGTATAAGCTC
CAGGCTCCCCGCATCCACAAATGGACTATCTTACACTACA
GCCCATTCAAGGCGGTCTGGGACTGGGTTATCCTGCTGCT
GGTCATCTACACGGCCATCTTCACTCCTTATTCGGCTGCG
TTCCTGCTTAGCGATGAGGAAGAAGAAGTCATTCAGCGCT
GTGGATACTCCTGCAGTACACTCAATGTGGTGGACCTCAT
TGTAGACATCATGTTTGTAGTGGACATTGTGATTAACTTT
CGTACAACCTACGTGAACAGTAACGATGAAGTGGTCAGTC
AGCCCGGCCGGATCGCCGTCCACTATTTTAAAGGCTGGTT
CCTCATTGACATGGTTGCTGCCATTCCCTTCGACTTGCTC
ATTTACCGCTCTGAAGAAGAGACCACGACATCCACAACTC
TGATTGGCCTGCTGAAAACAGCTCGGTTGCTGCGATTGGT
GCGTGTGGCACGCAAACTTGACCGCTACTCTGAGTATGGA
GCTGCTGTTCTCTTTCTGCTCATGTGTACCTTTGCTCTGA
TCGCCCATTGGCTGGCCTGCATCTGGTATGCGATTGGGAA
CGTGGAGAGAAGCGGCCCATCTCGAATCGGTTGGCTTAAT
TCTTTGGGTGATCAGCTGGGAAAGCCATATAATTCATCAG
TACGTGGATCAGGACCCTCTATTAAAGATAAATATGTCAC
TGCCCTGTACTTCACCTTCAGCAGCCTCACCAGCGTGGGC
TTTGGAAACGTCTCCCCAAACACAAACTCAGAGAAGATCT
TCTCCATCTGTGTGATGCTCATCGGAGCGCTAATGTATGC
CAGCATATTTGGAAATGTGTCCGCCATCATCCAGAGACTA
TACTCTGGCACTGCGCGTTACCACACTCAGATGCTGCGGG
TTCGAGAGTTTATCCGTTTCCATCAGATCCCCAACCCACT
TCGGCAAAGACTAGAGGAGTATTTCCAGCATGCTTGGTCC
TACACCAATGGCATTGACATGAATGCTGTGCTGAAGGGTT
TTCCTGAGTGCTTACAGGCTGACATCTGTTTGCATCTGAA
TCGTACACTGCTGCAGAGCTGTAAAGCTTTCAAGGGTTCC
TCCAAAGGCTGCTTGCGTGCTCTGGCTATGAAGTTTAAGA
CTACTCACGCTCCTCCAGGAGACACCTTGGTCCATGCTGG
AGATGTGATTTCAGCGCTATACTTCATATCTCGGGGCTCC
ATCGAGATTTTAAAGGGAGATGTAGTTGTGGCTATTTTAG
GCAAGAATGATATATTTGGAGAGCCCATTAACTCATATGC
TCGTCCTGGAAAGTCAAGTGCAGATGTGAGAGCACTTACG
TACTGTGACCTGCACAAAATCCACAGAGATGATGTCCTGG
AGGTCTTGGAAATGTATCCAGAGTTCTCTGACTACTTTTG
GAGCAATCTGGAAATCACTTTTAATTTGAGAGACACTAAC
ACTAAAGCTGGGTCAATGAGCAGTGACCCTGATGATTCGG
ACAATGGCGGTCTGGACCATCACACACGCAGAGCAAAGTT
GTTCTTTCAATCTAAAAGAAACTCCATCTCTCGAGATACA
GAGAGAACAGAAGACAGGCTCAACAGGATGACTTTCAGAA
CACAGACTTCAGGAAAACAGCATGAGAACAGACAAACTGC
TCATCGCAGCTCAGACATCTTTGCCTCACAGTCAAGCAGC
GATGAAGAGGAAGAGACTCAACGACCCTCTGTGATGGTGG
ACTGCTCTCAGAGCCATATCAATAGCGTTAGCAATGCTAA
CAGGGACAAGGACCACAACAGCAGTAACTCGTTCAACGCA
CTCTCAGGAGCTTTTTCAGGGGTTTCTAACATCTTTAGCC
TTTGGGGAGACAGCAGCCGTGGCCATCACTACCAGGAAGT
ACCCAGCCACAGCATGTCCTTCCCCTCATCTTCAGTTCCC
TCTAACACCGTCCTGCACAATGTCACCTATGGGCAATGCT
CAGAGGTAGAGAACAGACTGGAAATGATGCACAGGCAGCT
CTACCGATTGGAGAAGCGCATGTCAAAGGACATTGGAGCC
ATAATGCAGTTGCTTCAGAGGCAAATGGTGCAGGTTCCAC
CAGCCTACAGCTCAGTGACGTCTCCTACAGAAGCATCGCC
AATTCCACCCAAACCTGGACAGAAATTGGTTCAGCCTGTG
AATCCTTTAGAAACAGAGACTCCATCTATCCTGTCTGAGA
TACTTGATCCTCATGACTTTGCTGACAGTCCTATTAAGGC
CAGTGAAAGTCTGTCAGGTGCAATGGAGCTCCAGCTCCTG
GACTGTTCCTCACAGCCTCCCTCTGAGAATCCTTCTGGGG
CTTATATGGGGAGATGGTCACGTAGCGTAAGCCACCACAC
AAACACCACTGGTGATCCTACAGCACACATCCATCTCCAA
CAAACAGCCATAGCTGATCAAGCTCATTACAGCTTTTTGG
ATGCAGAGCCTATTGGAACTCTTCGCCAACCACAAGCTGT
ACAGAGTTTACATTTGGAGACCTCTGAGTGTTCAAGACGC
CAATCGCTGCCAGTAAAACATCAGGTCGAAGATGATTGCT
CAATGCAGAAAAGACATCCCTCTGATCCTGGCTCTTAAGA
CAAACTTGTTCGGTATCTCAGTGGAAAACAATGCAAAGAC
CACCAACATGTTGGCATGGTGTTTAAAAGACTATTCAGGA
TCATATATAATTACCTCAGAAAAACGGTCAAGGATGCATC
ATTATTGTCCCTGTAGGTTTGTACATTTGTGTTAGCTGGT
TTAACAATATTCATTGTTTTTACCTGCCTCATTATGAAAG
TGTTCTCATTGTTTTGAGGTGTAAATGTAATGATTTGTAT
TAGCATATCAGCTTTTTTTTTACAATGTGGTTTTGTGTTG
AATTGATTAGCCTATACTGTAGATTTTTTTTTAATAACTG
AAACACTGGAAAGGCCAATCAGAGCAGGATTTATTAGAGT
TCAAATGATCATTTGGAAACTTTAGCCCCTTTCATACATA
CAGACTTTTTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations