Transcript

fbxo36b-201

ID
ZDB-TSCRIPT-090929-13393
Name
fbxo36b-201
Previous Names
  • fbxo36-001
  • fbxo36b-001
  • zgc:153743-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000031759 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000031759|OTTDARG00000024276|ZDB-GENE-060825-271 fbxo36b|OTTDARP00000025814 fbxo36b-001 LG_ CR377211.7 Danio rerio protein_coding KNOWN, 968 bp
GTGTCCAAGCGGGAATGGCGAGTTTGCTTGGAGAAACTCT
GTTTGAGATCAGTGGACAAGGTCCTGCACCCATGAAGGAC
TATTTTCACTTTGCAATAACAAAGTCTGAGGTTATCTGGA
GCTGGTGGAAGATATCTTTGAGATTAGGCTGCAAGAATGC
ACCACCTGGACAACTGAGAGAAACACATGAAGACTTTCTA
GAAGACAACCGACTGCAAAATCAAGTGGCCATGGTATTTG
GTTCTCACATCTTGCAGTACTCCAAAAATTTATGTCAGGG
ATACTATGATTTCATTGCCCGTCTCCCCAATGCTTTACTT
TTTAAAATCATGGGATACCTTGACCTTGAAAACATTTCAG
TTCTTTCACGCACCTGCCGTAAATTTAGAGAGCTTTGTAA
CTCTGAGGAGTTCTGGGAGCAGACAGTGAGGAAGCATTGT
GACACAGTGACTCCAACAGTGGAGGCTTTAGCTAAGGAGG
TTGGCTGGAAGACAATTTTCTTCACCAACAAGCTGCAGCT
GCAGCTGCAGATTAGCCGCCGGAAGCAGAAGGACAATCAG
CCCTGTGAGGATAAAGATGAGCCCAGTTCCTCTTCAGTAG
CCCTGGAGTAGTTGGTTAAAGGCCCTATTCAAAGCTTATT
TTTTTGTCTAAAAAGATTTTCTTGGTAGAAGTAGAACACA
GTTTTTGCTTAATGAATGACGATTTCACTGTGTACTTTTT
ATGTATACATCTGCAAATATTACACATTTTCTCATATCTC
AAATATTTTTTGATCATATCAGAGCCAAAACATCTAATTG
TCTGGCATATTTATAGCAATTAAGAGACTTTTATAATACA
CACATGACAATTTTTCTACTTGACAATATACCTCACACAC
TACAACAGTATTGTCCTGTGCAAATGCCAATATTTGTGTA
CAACAGTTTCCATAAAATAGTTTAAATATATTAAAATTTT
AATCATTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations