header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-13054
Transcript Name: rgs13-201
Previous Names: rgs13-001, zgc:163081-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030962 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030962|OTTDARG00000023701|ZDB-GENE-070410-138 rgs13|OTTDARP00000025189 rgs13-001 LG_ CT583686.6 Danio rerio protein_coding KNOWN, 1279 bp
TTATTAACTGAAAATAACCGAACGGCTTGCCAACACGTAC
CAGTGCAGGAAAGGTTTTAAAGATGCCAACAATACTGTCA
ACTGAAATCGAAAACATGAACAAGGAGGATAAAGCTACCA
ATCCCAGGAGGCTCGAGAAGTGGCGGTTTCGTTGCCCATT
GACAGAAAAAATAAACCCTGGTGAGACTTCACAGTGGTCC
CAGTCCCTGGAAAACCTTCTCCGATCCAAATATGGCATGG
CAACATTTCACACCTTCCTCAAGTCCGAGTTCAGCGATGA
GAACATCGAGTTCTGGCTGGTCTGCGAAGATTTCAAGAAA
ACCAGAAGCTTGTCTAGGTTATCCTCCAGGGCCAAGAAGA
TATTTGAGCGATACATCAAAGCGGAAGCTCCTAAAGAGAT
AAACATCGATCACGTCACGAGAGAGCTTATCAAGCAGAAC
GTCCATGCTCCCACCAAAGTGTGTTTCGACGAAGCTCAGA
GGATCGTCTTCGGTCTGATGGAGAGGGATTCTTATCCCCG
GTTTCTCCGTTCGGACATGTACAGATCCCTTCTGGAATCA
GTCTCGAATGGGATTAAGGTCTGAGAAAGTGCTCAATGAG
AGACTTGAGGACTCTCCTGCGGGACTTTTGGTGCATTGGA
GCGAATGGGAGTGGAGTATTAAGGCTTCAGGCCTGGACTT
GAACATTGTGATCCACAAAAAGACTTGAATAAGCTATTGT
TAATCTGCACTGTATTACACTGCTCCATTGTTCTGCGCGG
CTGTGGAATACACGGAGACAAATGAGCTTTCGGTACCGCT
CACCTGTAAGGAACCACAAGGAGATCTGAAACAAGCTGCG
AAAACCAGAACCACCAGATGGACTTTATTTAACTTCTAGT
GCTTTGATTACTGGACGAGTGTCAATTCTGGTTAGCGTGA
GATGAAGTGGGAATAATACTAATGACGTTTGAAAAGTGAA
CTCAGTGAGCATTGATAACTTCATGATGTACAGAGCAAGT
GTAAATGCTTCAATGTTTGTTTGTTTTTTTACGGTAAATG
GGATTTTCTCATAGTAATCTGTATATGACTCACTTACTGT
AATGATTCAAAAGATTCATTTCGTGTTTCTCTGTTGGATT
GCAAGACAGCAAAGCAGAAAAGATTTTAAACAGGCTTATA
TTCCTGCACCAAAACACCTTATCTCTACAGATAATGTGAG
GAAAAGGCATTTCATAAACCTGTTTGTCTGACTTTTTAAG
AAGAGCTTATTAACTTAATAAACATAAATGTAAATTAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rgs13-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000030962 (1),  Ensembl_Trans:ENSDART00000132623 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC134221 (1) 1291 bp
CITATIONS (2)