Community Action Needed: Please respond to the NIH RFI
Transcript

matn1-201

ID
ZDB-TSCRIPT-090929-12743
Name
matn1-201
Previous Names
  • matn1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030557 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030557|OTTDARG00000023461|ZDB-GENE-050307-3 matn1|OTTDARP00000024890 matn1-001 LG_none CU104788.3,CU104776.12 Danio rerio protein_coding KNOWN, 2066 bp
TCTCTCTCTCTGTGAATCAGTCTGTCTCTGGTTTTGGAGC
AGGTCATTGGGACTCACGCCGCGCTACAGTATGACATTGC
CGGGGTTTGTGATGCTGCTATGCATCTTGGGAGCTCAAGC
CACTGTGGATCTGAGACAGGCTGCTGCTATGGCTGCAGGT
CTGTGTAACACCAAGCCCACTGATGTGGTGTTCATCGTCG
ACAGCTCTCGAAGCGTCCGGCCCTCTGAGTTCGAGCAGGT
TAAAGTCTTCCTGGCCAAAGTGATCGATGGTTTGAGCGTC
GGGCCGGACGCCACTCGTGTGGGTGTGGTGAACTACGCCA
GCAGAGTGAAGAACGAAGTCTCTCTGAAATCCCACAAAAC
CAAGGCTGCGCTGGTCAAGGCCGTGTCCAAGATTGAGCCG
CTGTCCACTGGCACCATGACTGGACTCGCTATCCAATTTG
CAATGAATGTGGCCTTCAGCGAAGCCGAGGGAGGACGCAA
ATCCCCTGACATCAGCAAGGTGGCCATCATTGTGACAGAC
GGCAGACCGCAGGACAACATCCGTGACATTGCAGCGAGAG
CGCGGGAGGCCGGCATTGAGATATTTGCCATCGGAGTGGG
CCGCGTTGACATGACCACCCTCAGGCAGATGGCCAGCGAG
CCCCTGGAGGATCACGTAGACTACGTGGAGAGCTACAGCC
TCATCGAGAAGCTCACCAAGAAGTTCCAGGAGGCCTTTTG
TGCGGTTGTGTCGGACCTATGCGCGACTGGTGATCATGAC
TGTGAGCACATTTGCATCAGCACACCCGGATCTTTCAAGT
GCGCCTGCAGAGAGGGCTTTACACTCATGAATGACAGCCG
ATCATGCTCAGCTTGCAGTAATGCAGCCACAGATGTGGTC
TTCCTGATCGACGGCTCCAAGAGTGTGAGACCCGAGAACT
TCGAGCTGGTAAAGAAATGGATCAACCTGATTATCGACAA
ACTGGACGTGTCAGAAACCAACACCCACGTGGGACTGGTG
CAGTACTCCAGCACTGTGAAGCAGGAGTTCCCACTGGGAC
GCCACAACAGCAAACGATCCCTGAAAGAAGCTGTGAAAAG
GATGGACTACATGGAGAGGGGAACCATGACAGGACATGCC
CTCAGTTTCCTGGTGGACAACAGCTTCGGTCCTAACCAGG
GCGCCAGACCAGGAGTGCCGAAAGTCGGTATTGTCTTCAC
AGACGGCAGGTCGCAGGACTACATCGGAGATGCCGCCAAG
AAAGCCAAGGCGCTAGGCTTTAAAATGTATGCTGTGGGAG
TCGGCAATGCAGTTGAGGATGAGCTGAGAGAGATCGCCTC
TGAACCGATCGCTGACCATTACTTCTACACGGCTGACTTC
AAAACCATGAACCAAATTGCCAAGAAGCTGCAAATCAACG
TTTGTCAAGAGGAAGATCCCTGTGAATGTAATTCCATTAC
CAAGTTCCAGAAAAAGGTGGAGGAAGCACTACAGGCGTTA
ACAAAGAAATTGGAAGCTGTGACGAAGAGGATCGCTGCCC
TGGAGAACAAGATCGTTTGAGATGGCGGCAACATCTAATC
CTTACACTGCCATTCTTTTCAATACTTGTAAAAACCCAAA
CGCCTCCTGTGACCTCTTAAGTCTGTCTTCTCCATTGCAT
CTCTTTCTGCTTCTCTGCCTTCATCGCTATTGTCCATAGG
GATGGAGCACTGAAAAAAGCTGAAGGTGTCGATTCTCAAC
CAGTCATCCCTCATAACAAAACCCTGTGTGCGTTGAGTAC
ATAAATCCACCCATATCCACCGTCTTCACACACAAGCTGG
ACAATAAGGTCTTCTTTATGGGGACGTGGTGTGTAAATTA
ACTGAAGAAACCGCGTGTTGCCCCTGAAATATTCTTTTAT
ATGAAGTATATATATGATGGTAATTTAATATAAAGATTGG
ACTTGAAATAAATGCGGGAATGCTTGATTATCCACACATA
CGCAGACATGCCACAAACACACACACACACGGGTAAACAT
ACACCGACTATACAAATGCTAACCATACGGCTTGTGATGA
TTCAATAAAGTCTCGTTTTGTGTCTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations