Transcript

rpl7a-002

ID
ZDB-TSCRIPT-090929-12494
Name
rpl7a-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030240 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030240|OTTDARG00000023245|ZDB-GENE-031001-9 rpl7a|no_translation rpl7a-002 LG_ CU019641.4 Danio rerio protein_coding KNOWN, 816 bp
TTTCCGTCTGAACCAACATGCCCAAGGGAAAAAAGGGTAA
GGGGAAGAAGGTGGCACCAGCCCCTTCAGTGGCCAAGAAA
CATGAGGTCAAGAAAGTTGTGAACCCCCTGTTTGAGAAGA
GGCCCAAGAACTTTGGCATTGGTCAGGACATCCAGCCGAA
GCGGGATCTGACCCGATTCGTGAAATGGCCACGTTATGTC
CGGCTGCAGCGTCAGCGAGCAATCCTGTACAAGCGACTGA
AGGTCCCCCCTGCGATCAACCAGTTCACCCAGGCTCTGGA
CCGCCAGACCGCTACCCAGCTGTTCAAGCTGGCTCACAAG
TACAGGCCTGAGACCAAGCATGAGAAGAAACAGAGACTGT
TGGCTCGTGCTGAGCAGAAGGCTGCTGGAAAGGGAGATAC
ACCCACTAAAAGACCACCAGTCCTGCGCGCAGGTGTGAAC
ACTGTGACCACGCTTGTGGAGAGCAAGAAAGCACAACTGG
TCGTTATTGCTCATGATGTGGATCCCATTGAGCTGGTGGT
GTTCTTGCCTGCTCTGTGCCGTAAAATGGGTGTCCCATAC
TGCATCGTCAAGGGCAAGGCCAGACTGGGCAGACTGGTGC
ACAGAAAAACCTGCACCTCCATCGCCTTCACACAGACCAA
TCCGTGAGTAAAACACAAACACTCAGTTAACTTTCCTTTG
CTGCACATCCTACAGCTATGATGTCTGAATTTCTTCACCT
GAACAACCATGTGGTTTAAATGAGCTTTTTAACCCTGAGC
TAAATGGTTTGCATCTAATCATACATTTGGTGGTTTTTGA
ATAAGTTTTTGTTGGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations