Transcript

stag2a-201

ID
ZDB-TSCRIPT-090929-12358
Name
stag2a-201
Previous Names
  • stag2a-001
  • si:dkeyp-20g2.6-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000030078 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000030078|OTTDARG00000023146|ZDB-GENE-030131-3432 stag2a|OTTDARP00000024543 DKEYP-20G2.6-001 LG_ CR926467.10 Danio rerio protein_coding NOVEL, 5371 bp
TTCTCGAGACTGTATTTTTACTCCTGTCCACCCACAGCAC
CAAACTGTCTCTTTTAGCTACGAAACACCAACAGAACTGA
GCCAGTTCCACTTGGATAATGTTTTAATGCTCTAACCGCG
GAGCTCCGGTCCGGTTCGGTTCTGTTCGGCGGCGTATCTG
GCCGGGTTTGATGCTGCTGGACTCACGCTGAGGGAGTGTG
GGGACACTTGAACTCCAGAAGAGACAGAAGATGTTGAGAA
AATGATAGCAGCTCAAGAGCTTCAAGCAGACTTTTACCAG
GAAGGACACTCTCTGCTCTCGGACACAGATCTTGAAGATC
ATGAAGGGCGAAATGGCAAACTTGCAAAAGGAAAGAAGGG
CAAGAAGAGCATTGGGGAGAAGTTGAAGGGGTCAGAGGTG
AGAGGTCGGGTCAATGGCCACCATCAGGAGAATGACATGG
AGAATCTCAGCTTGTTTGAGATTGTCAGATTGGGCAAAAG
TGCCACACAGTCAGTGGTTGATGACTGGATCGAGTCCTAT
AAAACTGACAGAGACTCTGCTCTGCTGGAACTCATCAACT
TCTTCATCCACTGCTCTGGTTGTAAAGGTACGGTGAGCTT
CGAGATGTTCAGAAACATGCAGAATTCTGAGATCATCAGG
AAAATGACGGAAGAGTTTGATGAGGACAGTGGCGATTATC
CGCTGGCGATGGCAGGTCCAGCGTGGAAGAAGTTTAAAAC
AAACTTGTGTGAGTTCATCGCGACCCTGGTCCGACAGTGC
CAGTACAGCATCATCTATGATGAGTACATGATGGACACGC
TCATCTCTCTGCTCACCGGCCTGTCAGACTCACAGGTCAG
AGCGTTCAGACACACCAGCACTCTGGCAGCCATGAAAATG
ATGACTGCTTTGGTGAATGTTGCTCTAAATTTGAGCATCA
ATTTGGACAACACGCAACGACAGTATGAGACTGAACGCAA
CAAGAGCATCGGCAAACGAGCCAATGAACGTTTGGAACTA
TTGCTGCAGAAGCGCAAAGAGCTCCAGGAAAACCAGGATG
AGATTGAGAATATGATGAATGCCATTTTTAAAGGTGTATT
CATCCACAGATACAGGGATGTGATTGCTGAGATCCGAGTC
GTATGCATTGAGGAGATTGGCATGTGGATGAAGATGTACA
GTGAGGCGTTTCTTAATGACAGTTACCTGAAGTACGTGGG
CTGGACCATGTATGATAAGCAAGGTGAGGTGCGTCTGAAG
TGTCTTACAGCTCTTCAGGGTTTGTATTACAGCAGAGAAC
TCAACGCCAGACTGGAACTCTTCACCAGCCGCTTCAAGGA
TCGAATCGTGTCCATGACTCTGGATAAGGAATATGATGTT
GCTGTTCAGGCCATTAAGCTGCTGACGCTGGTTCTGCAGA
GCAGTGATGAAGTCTTGATGGCTGAAGACTGTGAGAGTGT
CTATCACTTGGTTTACTCCGCCCATCGACCGGTTGCCGTG
GCAGCAGGGGAGTTTCTCTACAAAAAGTTGTTCAGCCATC
ATGGTCCAGAGGATGAGGGGCGGCCCAGGAGAGGCAGACA
GTGTTTGAATGCTAACCTCATCAGAACAACTGTCTTATTC
TTTCTGGAGAGTGAGCTGCATGAGCATGGTGCCTACCTTG
TGGACAGTTTGTGGGACTGTGCATCAGAGCTGCTGAAGGA
CTGGGAGAGTATGATCAGCCTGCTGCTGGATGAACCCTTT
CCTGGAGAAGAGGCTCTCAGTGATGCTCAGGAAGTTGCTC
TGATTGAGATCATGTTCTGTGCTGTCAGACAGACTTGTGA
GTGTCACCCACCCATCGGTCGAGGCACTGGGAAAAGGGTT
CTCACAGCTAAAGAAAAGAAAACCCAGTTGGATGATCGAA
CAAAGATCACAGAAACATTTGCTGTGGCTCTTCCTCTGTT
ACTGGCTAAATATTCAATGGACCCTGAAAAGGTCACTAAT
CTGTTGCAGTTTCCTCGGTATTTTGATTTGGAGATCTATA
CAACCGGTCGCCTAGAGAAGCACCTTGATGCTTTACTACG
TCAGGTCCGTGATGTGGTGGAGAAGCACACAGACACAGAT
GTTTTAGAGGCCTGTTCCATGACATTCCAAGCACTGTGCA
ATGATGAGTTTACCATCTATAACCGCGTAGACCTTGTGCG
CAGCCAGATGCTCGACGAACAGATCGACAAGTTCCACCGC
CTCCTGGAGGACTTCCTGTTGGAGGGGGAAGAGCCTGATG
AAGATGACACCTATCAAGTTTTATCAACCCTCAAAAGAAT
CACAGCCTTCCACAATGCCCACGACCTCACTAAATGGGAT
CTTTTCACCAGCAACTACAGACTTTTAAACTCTGGCCTGC
AAAACGGAGATATGCCTGAGCAGATTGTGGCTCATGCCCT
CCAGTGCACTCATTATGTCATACTCTGGCACTTGGCTAAA
GTCTCAGAAGGCAGTGCCAGTAAGGATGATATGGTGCTCT
TGCGGAGGCAGGTGAGAGCCTTCTGTCTGATGTGTCAGAG
ATACCTGAACAGCATGAGCACTGCTGTCAAAGAACAGGCC
TTCACCATTCTCTGCGATGCCCTTCTGATCTTCAGTTATC
AGATTGTGGCGTCGGGACGGGAAATTTTAGAGCCTCTGGT
GTTCAGTCCAGATGCATCCCTACAGAGCGAGCTTCTAAAC
TTCATCCTTGATCATGTATTTGTTGAGCAGGATGAGGATG
GCAGCACAGATGATGAGGCCGGTAAGATTGAAGCGCTTCA
CAGACGCAGGAACTTATTGGCAGCCTTCTGCAAATTGATC
ATTTTCAATGTGGTGGAGATGAAGACAGGAGCAGATGTCT
TTAAACAGTACATGAGATACTATACCGATTACGGTGACAT
CATTAAGGAGACCATGAGTAAAGCACGTCAGATTGACAAG
ATTCAGTGTGCCAAGACTCTGATCCTCAGCTTGCAGCAGC
TCTTTAATGAGATGCTGAGTGATCTGGGCTGTAACTTTGA
TCGCTCCACATCTGCTTTCTGTGGGATTAAAGAACTAGCT
CGACGCTTTGCACTTACGTTTGGCCTCGATCAGCTAAAAA
CCAGAGAAGCCATTGCGATGCTCCACAAGGATGGAATAGA
ATTTGCCTTTAAAGAACCCAGTCCACAGGGTGAGGGCGGC
CCTCCTCTCAACCTCGCTTTCCTTGACATCCTCAGTGAAT
TTTCCTCCAAACTACTGAGGCAGGACAAGAAGACTGTGCA
CGTGTATCTAGAGCGGTTTATGACGTTTCAGATGGCCCTT
CAGAGGGATGACTGCTGGCTGCCGCTCATCTCCTACCGTA
ACTCTCTGCAGGCGGGCGCTGATGATGACACGCTGTCCGT
CATCAGTGGTATGAGCAGAAGTTCTGCCCGCAGTCGCAGG
GGCAAACCACCTGCCGCCAGCAAGAGAAAACTGCCCGATG
AGGACAGTAGTTGTAGCAGCAGTGATGTCAGCATGTGGGT
GAACCGTGTACAGACTGTCCCGCACTCTCCTGTAATGATG
TCATCTCCTCACATCGTCTCTACTGTCCTGCGGGATGCAA
AGAAGCTCCGGCCAGAGCAGGGGTACATTGGGGTTTACAG
TATGAGCAACGAAGCGCAACACACACCCCTGCAGCAGCCG
CATCAACACATGGACTACAATTCTCAGGTTGCATGGATGA
TGGCCCAAAAGCAGCAGCAGGAGAGAGCAAACCTGCAGTA
CGGCAAGATGAGAGGCCACATTCAGCACACTATTCGCCGT
GGCAGTGGGCTGATGGAGGATGATGAGGAGCCGATTGTAG
AGGATGTGATGATGTCATCAGAGGAACGTCTGGACGACCT
TAACGAGGGCATGGACTTCGACACCATGGACATTGATCTG
CCTCCATCCAAAAACCGCAGGGAGAGATCAGAGCTGAAAC
AAGACTACTTTGACCCTTCCTCCATCATGGACGATTCAGT
TCTGAATGTCTCCATGTTCTGATATGGGTAAATGAGAGCA
TCGGTGACCTGTTTCTCCTCTTCTGATTTCACTCCATGGA
CTAATGCACAAGATGGTGCTGTGTATCTTTTCCTCCCGAA
AACACACCACGACTTTCCATCTGTACATATAACAGCCCAC
AGGGCATCAGACAGACATTTACAGCATGAGATCAGACCTA
TCTATTTGTAACGGAGGTTTAAAAATAGCTGTTTTTTGTA
ACTCCCAGAGGAGTTTTGATTTTTAGGTAATTTTGTAAAG
ACAATCAGTTGTAAATGACTTTATAAAGTGTGATTTTAAA
TTCAAAATTTATAATTCAGCTTTCCTTGAAGCGTTTAGAC
TTGCAGTGTGTTTTATTCCCCAGTATTTTTTTTTTATTTA
ATCCATTACTCACAATGTTTTTGCTCCCCATAAATAGGTT
AAACCTGGTATTGTGATAATATTCCTCACTCATTACTTGT
ATGGTTGTGATTGGCTGATTGGTCCTTTAATAACTCAAAG
CACTTGCTGATTGGAACTTTAAAAGCATGCCCATCTTTCA
TATTTAATTACTTTTTTAAATATATCTATTTTTCAGCTTT
AAATTTCGAAGGTATTTCTGCATCCAGGGCATTGCCCCCA
TTTTCACACAAAAGCTTTCTCTGTAGGATATTTCTAATTC
TTTTTTTGAATATTAGAATTAGGTATTATAATATATTGTT
ATATCTTAAAAAATATAATTATATGTATTATTTTGTTTTA
CACAAAATGCGTCATGTAATGTGAATCGTTGCTGATTTAT
ATTTAAGTTGTTGTTTTTTTATGTTTGGTATCCAACCTAC
TGTTTCAGTCACACTGCATCTGTCCTGAGAGAGTCACTGA
TGTTTTATTCACTTTCATTTTGGAGAAGCTCCACTGTGAA
AAAATTCTATAAATCTTTCCCCTTTGTGTAGTTTTTTTTG
CGTTTTAGGATTGAGCTTGTAGGTTGGTTTGGGTAATTGA
TATCACGGATGGATTGTTAATCAAAGTGAAACATGATGAT
TGTATTTGTGCTGAGAAATCTTGGTAAAAGTAACCGTGGT
AAATGTTTCCCGGGTAAATGCATTTCAGCAAGGAGCTTTT
GGTCATGCAGGGTTGGAAAGAAACCATCCTTTTTTCATGT
GTTTCACACATAGTTGGTCATTTTTCCCACTTTTCTATTA
ATTTCTAGTCCTGCAATGTCGCCTTGTTTCCAAAAGTGTG
TGAGTGTATGTATTTTAATGTATTGGACTGTACATAAAAA
CCAAGATGTTTTTATTCTATTTACAAGATGTCTCTTGTTT
CATTTACAATGTTTATGCCTTTTTATTGTATACAAAATAA
AACTTCCTCATCTTTATCACTGCTGTTTTAATCAGCAGCT
CCCACAGACAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations