Transcript

ckmb-201

ID
ZDB-TSCRIPT-090929-12178
Name
ckmb-201
Previous Names
  • ckmb-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000029798 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000029798|OTTDARG00000022949|ZDB-GENE-040426-2128 ckmb|OTTDARP00000024315 ckmb-001 LG_ CR855332.7 Danio rerio protein_coding KNOWN, 1624 bp
CCCATCAAGAAGTGCAGCTATCCAATGAAGTTCAAGCATG
CAGGAGCGGGACAACCAATGGGCAGCAAACATTGAAGTAT
ATAAACCAAGGTCTGACGTCTTGCAAAGTTGGGCAACCCC
TACATTGGCTTGGTGAACAGGATCTGATCCCAAGGACTGT
TACCTTTTCTCCCATACAGATTGCCGGAAAAGTGCAATCA
TGACTAAGAACTGCAACAACGATTACAAGATGAAGTTTGC
TGTGGATGAGGAGTTTCCTGACCTCTCCCAGCACAACAAC
CATATGTCCAAGGTCCTCACCAAGGACATCTACAACAAGC
TCAGGAGCAAGTCAACCCCCAGTGGATTCACCCTTGATGA
CTGCATCCAGACTGGTGTGGACAACCCTGGTCACCCCTTC
ATCATGACTGTCGGCTGTGTGGCTGGGGATGAGGAGTCCT
ATGAAGCCTTCAAGGAGTTGTTCGACCCCGTCATTTCTGA
CCGTCATGGTGGCTATAAGCCCACCGACAAGCATCTTACT
GATCTGAACTGGGAGAACCTGAAGGGTGGTGATGATCTTG
ACCCCAACTACGTTCTGAGCAGCCGCGTACGTACCGGCCG
CAGCATCAAGGGATTCACCCTGCCTCCTCACAACAGCCGT
GGTGAGCGCAGAGCTGTGGAGAAGCTGTCCATTGAGGCTC
TGAACAGCCTGGATGGTGAGTTCAAGGGCAAGTACTACCC
ACTGAAGGACATGACTGACAAGGAGCAGGAGCAGCTCATT
GCTGACCACTTCCTGTTTGACAAGCCTGTGTCCCCCCTGC
TGTTGGCTGCTGGCATGGCCCGTGACTGGCCTGACGGTAG
AGGTATCTGGCACAACGACAACAAGACCTTCCTTGTGTGG
GTGAACGAGGAGGATCACCTCCGTGTCATCTCTATGCAGA
AGGGTGGCAACATGAAGGAGGTCTTCAAGAGGTTCTGCGT
TGGCCTGCAGAAGATTGAGGATGTTTTCAAGAAGCACAAC
CACGGTTTCATGTGGAACGAGCATCTTGGTTTCATCTTGA
CCTGCCCCTCTAACTTGGGTACCGGTCTGCGCGGTGGTGT
CCACGTCAAGCTGCCCAAACTCAGCACACATGCCAAATTT
GAGGAGATCCTGACCAGACTGCGTCTTCAGAAGCGTGGCA
CAGGTGGTGTGGACACAGCCTCCGTCGGTGGTGTGTTCGA
CATCTCAAACGCTGACCGTCTGGGCTCCTCTGAGGTGCAG
CAGGTGCAGCTGGTGGTCGATGGTGTGAAACTCATGGTTG
AAATGGAAAAGAAACTGGAGAAGGGCGAGTCCATCGATGA
CATGATCCCTGCCCAGAAGTAAACTGCCAAAAGTGTTTCT
TTTTTTTATTTGTTCATGCAGTCGTGCCATCATGACTTTT
CCAAAAGACACTCCACCCTGCTTCCTTTTGTCCTACTTTT
TTTTTCTCCTTCCTTTCTTTCCTGTCGTCTTCTTTTTCCA
GCACTTTTTCTTCTTATCTTGCTGTTCCTCCTGTAACATC
CTGGGATCAAACATCCACATAGCTAGAAACCCCTAGCTGT
GTTGTATTCACCTAAACTTTTTTGGTTGTACAAAGTTTAA
TAAACGGCCCCATGTAACAATCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations