Transcript

tmem62-202

ID
ZDB-TSCRIPT-090929-11923
Name
tmem62-202
Previous Names
  • tmem62-001
  • zgc:77419-001
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000029534 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000029534|OTTDARG00000022805|ZDB-GENE-040426-1837 tmem62|OTTDARP00000040041 tmem62-001 LG_ CR318625.10 Danio rerio protein_coding KNOWN, 2282 bp
TGCGGCTCCGCTGGCGCTCAGTGAACCGGCTGCGCGGGGA
TGTCCGGCCGTGTGAGTGCTCCTCCGGCATGAAGCAGGGC
TCTCCGTGACTCCTCCAGGATGCTCCGGCTGTTCGCGGCT
CTGGTGGTCCTCGGGCTGCTGCTCGCCTGCTTCACTTCCT
GGCTCTTCGACAGCTATGACGGCGCCTGGCACCCGAAACG
CAGCTTATTCCCCCAGTCCGGGCGCAGCGGCGGCCCTCCG
CACCCCGGCGGACAGCGGGACAACATCTTTTGGTTCGTGC
AGGTGTCCGACATCCATATCAGCCGTTTCCACGATCCGAG
GCGCATCCCAGACTTCGAGAAGTTCTGCACTGACACTATT
GACGTCATTAAACCTGATCTTGTGCTGGCCACAGGGGACT
TGACAGATGCAAAGACTGAGAGTAAAATGGGCTCTCTTCA
ACATGAAGTGGAGTGGCAGGCCTACCACAACGTCCTGAAA
AGATCTCGAGTGCTGGAACGCACAAAATGGATTGACATTC
GTGGAAACCATGATGCCTTTAATATCGTTTCTCTGGAGAG
CGTGAACAATTATTACAGGAAATACTCTGCCAATCAGAAA
GTAGGATCCTTCCACTACGTACACAGAACTCCCTTCGGGA
ACTATTCGTTCATTTGTGCTGATGCCACTCTGGTCCCGGG
ACCAAAACGGCCTTATAACTTCTTTGGGATTATCGATGAG
TCTCAGATGGACATGTTGGAGACCTTCAGAGAGGAGAGCC
TGAGCAGTAACAAGTCCATCTGGTTTGGACATTATACCAC
ATCCACTGTCATCTCCCCCTCCCCAGGAATCCGAGAGCTC
ATGAGTACAGCTGTGGCATATTTGTGTGGGCACCTACACA
CACTGGGAGGCTTCATGCCGGCTCTGCACAGTCGCCATCA
AGGTGGCACCCTGGAATTAGAGCTGGGAGACTGGATGGAC
AATCGCAGGTACAGGATTTTGGCTTTCGACCATGACCTGT
TTAGCTTCTCCGACTTGACGTTTGAGGACTGGCCCGCCAT
GCTGATCACCAACCCTAAAGACGCACAGTACCTGCAACCA
GGAGTGGAGCCTCTGGGTCGAATCCGCAGTTCCACTCACA
TCAGGTGTCTCTGGTCCTTGCTTTCTCTGAATCCCCCATC
ACAGCCGTGTACGTGAGCGTGGACGGAGTTACACTGGGAA
AAGCAGTCAGCGCTGGAGGTCCTCTATATGTGCTGCTCTG
GGATCCAATGCACTACGCTACAGGACTGCACACTATCAAA
GTCAAAGTGGAGGACTCTGCAGGCCGCTCAAAAGTGCGTG
AGCAGCAGTTCACGCTGGAGGAAGAGCTCACTCCCAGCTT
CGGCTTCGTGCAGTCCTTTATCCTCCTCACAGACCACTAC
ATACTGGCACGGATCGCTTTCGTAGTAATAGTTTTACTAA
ACCTTGGTGGGCTTGTACTCTTCAGATTTATGCCAGTCTC
TTCAACAAGAGGACTGTCCTCTCAAGCCTGGATGTCCCTG
CATCTGGTCAGCAAGAGCAACGTGTTCTTCTACACTCTGC
TGCTGTTCAATCTGTGTACAGCATTAGGTCCGTGGTTCAT
TGGGGAGGTCATTGATGGACACATTGGCGTCTGCTTTGCT
TTCGGTGTGTTTGTGGATGGGCATTTCCTTGAAGGCAGCC
TGACGTATGTTGTGGGATTCATTCAGGTGCTGTTCTTCAA
TATGCCCCTCACCTATTACCTCTGCTGGAGTCTCCACCAC
AGGTGTCGCGGCACCAACTTCCGCTCTCATTTCTGCCGGC
CGGGCTGCCGATGGAGGACTCTGGCAGTACACCTCGGCAT
GCTGGTCCTCATGATCTGGCAGGCCTATTCATGCTACTTC
CTGCTGGAGACCTACGGGTCGCTGGCCTTCTTCATGTCAC
CTGTACGCACCTGGGCCCTCCTCATGGGCCTGCTGCTGGT
GTACAGGGCATGGTGGGGGAAACCCCTGCGCTTCTCCGAT
GGCAGCAAAACCAACCGGCCGTTGTGACGGTGACCGATTC
ACCTCGTCTGTATCGTTGTGCCGGGCGTTGTTTTGTGCCA
AACTCTTCCCTCCTTTCGACAGATTTCCATTAGAGATATC
GAAAATAGTACTTCGTTGTATTGGAGCGATGATGACATCA
CTAGCGGATGACGGAGCTGTCTGAAAGTTCACTAATACAC
GTCGGTAGGTTGCCAGTTTCCACCGTTGTGAACCCGAGCA
GTTGTGTGAGGTTTATTCCGTTGATAAACTGAGCATTGCG
TA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations