Transcript

wdr92-201

ID
ZDB-TSCRIPT-090929-11762
Name
wdr92-201
Previous Names
  • wdr92-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000029364 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000029364|OTTDARG00000022712|ZDB-GENE-050417-93 wdr92|OTTDARP00000023978 CH211-274C22.5-001 LG_ BX323887.10 Danio rerio protein_coding KNOWN, 1709 bp
ATTGAAACAAAGAAGAAGCAAACAGCGCAACTGACATCTC
TTTCCTTCTGCTCAAACTGATAGATTTTAGTTTCATATTG
AGCACAGATCATGTCAGCAGCTCTCGAGAAGCCGCAGATC
ATCGCGCACATCCAGAAGAGCTTGAACTACACGGTGTTCG
AGAGCAAATGGATTCCGTGCAGCGCCAAGTTTGTTTGTAT
GGGAAACTTCGCGAGAGGAACCGGAGTGATGCAGATCTAC
GAGATCCAGCACGGGGAGCTGCAGCTGGTCAGAGAGATAG
AAAAATCCAAGCCAATCAAGTGTGGGACGTTTGGAGCCAC
GTCTCTCCAGCAGAGGCATCTGGCCACCGGAGACTTTGAC
GGAAATCTTAACGTTTGGAATCTGGAAGTGCCCGACAGCC
CGGTGTACTCAGTTAAAGCACACAAGGAGATCATAAACGC
CATTGACGGAGTGGGAGGACTGGGCATCGGGGACGGGGCT
CCAGAGATCGTCACTGGAAGTAGAGACGGCACAGTGAAGG
TGTGGGACTCCCGGCAGAAAGACACGCCGGTGGTCAACAT
GGAGCCCACAGAGGGAGAAACCAAGAGGGACTGCTGGACG
GTCGCTTTCGGTCATGCTTTCAATGATCAAGACCGCTGTG
TGTGCGCTGGATATGATAACGGCGACATCAAGCTGTTCGA
TCTTAGAAACATGTCTTTACGATGGGAGAAGAACATCAGA
AATGGGGTGTGCTCTGTTGAATTCGACAGAAAAGACATCA
ACATGAACAAACTAGTGGCCACATCTTTAGAAGGCAAGTT
TCACGTGTTCGACATGAGGACGCAGCACCCCAGCAAAGGC
TTCGCTTCAGTCTCCGAGAAGGCTCACAAATCCACAATAT
GGCAAGTGAGGCACTTACCTCAAAATCGTGACGTCTTCAT
GACAGCCGGAGGAGCGGGAAACCTGCATTTATGGAAATAT
GAGTATCCGGCCCAGAGGAGTAAGAAGGGAGCAGATGATG
TGGAGATGGGGGTCGCTGGATCTGTCAATCTCCTCCAGAA
CGTGACTCTGTCCACACAACCCATCTCCAGTCTAGACTGG
AGCCCGGATAAACAGGGTCTCTGCGTCTGCTCCTCATTCG
ACCAGTCTGTACGAGTGCTCATAGTCACCAAACTCAACAC
TGTCTGAGCCAACAGTACATCACTTTTATTCTCCAACAGA
CTGGAATATCTGATGACTGTTTACATGAACGTGTGTGTCT
TAAAGGGACAGTTCACCCCAAAATATAATGTACTCACTAT
TTATTCTTCCTTGTGTGGTTTTCAAACTTTTATTATCTTT
TATCGGAAACAAAAGAAGATATTTCCATTAATGTTGGAAA
CCTGTAACCATTGACTTCCATAGTAGGAATAACAAGTACT
ATGGAAGTCAATGTTTTTCAGAATATCTTCCCTTGTGTTT
AATAAGTTAATAAGCTCAAAGGTTTGAAACAAGGATGACA
ATTTTAATTTTGGGGTGAACTATCCCTTAAGTAAATCTGC
AATTGTATTCGAGTTGATTAGTTTTTTTACAGACAAGTGT
TATGATGCTTTATAACACTGGATGTAGTTGTGACTTTGCT
TTGCTAGCACTGGTGAAATGGGTTCTTATGCCCAAAGTGA
AGGCCTTCAGTGCTATGGTGAAGTTATTATTGATCTTTAA
TAATAAAATCAAAACATGAATTTCTATTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations