Transcript

zgc:66447-201

ID
ZDB-TSCRIPT-090929-11257
Name
zgc:66447-201
Previous Names
  • zgc:66447-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028814 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028814|OTTDARG00000022393|ZDB-GENE-030131-4748 zgc:66447|OTTDARP00000023565 DKEY-152P16.2-001 LG_ BX957302.15 Danio rerio protein_coding KNOWN, 2711 bp
GATAGCAAACGAGCTAACTAGCTCAACACAGCCAAAATAC
TGTGTTTATAGCATAGCAACGGTAAAACAGCGGTTTTACC
TTTTTAAAATCGATTTATTTTGTTAAAATATTGAAATAAT
AAATCGGACATTTGCCGAAACTGTGGCGAGAGGTGAGGAG
AATGGTGGTCCCTGATAGTGGAAGTGATATTCAGCCAGCG
GATAATGGTGATACAGACAAGGTGATGTCCAATTCTGAGC
CTGAACTCGACCCAAACCTGACCACTGTGGAGCTTGAGGA
AGTCCGTAAACTACAGGATCTGGTGCGGCAGCTGGAGGTC
CAGAATCAAACCCTTCATAACAGAAGCAGAAAACAAGTGC
TTGGAGGCACCAACAATAGCAACCTCAAAGCAGGAAGTAA
TATTAATAACCTGCACAAAGTCATGGACACTTCTCCCGGA
GCAGAGGAGGCTGGGAACTTGGAGCTCTCTCCTCCAGCAG
ACAGCAGTGGCAGTGAAGACATGTCTCCACTACCTGACAC
CTCCAGGGTAGAGGAGCAGGATGGGTTTCTAAGCTTACCG
TGTTCTTCTGGCTCCAAACAAACCATGGGATGGTTTGTCA
CAAGTAACTGTGATTCAGGCATGCTGGGAGCAAGTGAAGC
AAGTAAGGACCAGTCCGCCCTGGATGAAGTCGATGTGCTT
GACTTGGAGTTATGTGCTAAAGCTGAGGATGAAGACAGTT
GGTTGTATGTCTCACCAAAAAAGGAGGTTGTGATAGAGCA
TGGACCTGAATCACCACTGAAATGGTGTAGAAAAGTTCTT
GATCACCCCAGTCCAGCAACTGAAGTCGCCTGTCGGACAC
TCATCAACCGATTAGACCAATCATCTAGATGGAAGAATGT
GTACAGTAGCCCATCTCAGACATCTGAGGCTGGTGTCTCA
GCATCATCTTCTGCTGGGTACCTCAAATCAACTAACAAAA
CACTACTAACCTCTGGCAGCTCAGGTTACATGGGGGTTTA
TTCTGCTCTCAGCTCACAGTCCTCTGTTGACAGTGAATTA
AGCTCTGATGAATCCATCTCCATGGGCTATAAGCTTCAGG
ATCTGACTGATGTTCAGATAATGGCTCGCCTGCAAGAGGA
GAGTCTGCGACAGGACTACGCATCTACCTCTGCCTCGCGT
CGCAGCTCATCTGCGTCCCTGCAGTCTTTACGTCGAGGAA
CCTACAGTGATCAGGAATTTGACTCATACAGTCAGGAGGA
TGAGGAGGATGAATGCTGCTCTCTGCCGCAGCATCTGCAG
CGTTACTCTCCATCACCCCACAGCTCTCCTCGCTGCCTTT
CCCCCAGTACACTGGCTGAGTACAACCGCCTTTCTGCCCC
ACGTCCACGCTTGTCCCGCTGTTCCCTTGCTGGTGCAGGG
GCTAAAAGTGAAGAGGAGCTCAGACACAGTATGCCTAACT
TGACCCCACGCACCAGCCTGCGCTCTTTGGAGGCAGTCAG
AAACAGCCGCAGCATGGAGGCTAACTTACAGAGTTCTGGC
AACCGCACGTCCTGCCTGCCCCACTCCCCTAAAGGTGCAT
CATCTTCAAGGATGAGGAGTGATGGCCAGTCACCTCTCTA
TCTGCGAGCCCCCATGAAAGCTCTCAGCCCTGTGGGGTCT
ATGTCTGCATTGCGACAGCATGCCAAAGGGCCACCAAGTG
CACAAGTTGGGCACACTGAAGCAATGAGGAGGGTTCAGTC
CCCAGGTTCCAAAAATGGTGTTGGATATTCAGGCTGCAGG
ACTGCTGTTGTCACCAGGCAAACGCCTGGAAGAGGCATGA
CGCCAGCTTCACCTTCTTCCAGAACTAGACTTCCACAGAC
TCCTAGAAGTAGGTCACTAGGGATGACCAAACCATCTGGC
CACCTTACTGATGAATCCTGGAAAGATGGATGCTACTGAA
GCTCGGAGAATTTTGTTTGTAAATTTCACAGAGAACTCCA
GCGTGGTACCACTGCCTCAGAAGACACGGCAAAGGAAAAT
CAGCACAGAGGTCCTAAAACAAGAGTGATGATTAATAACA
AGCCTCCATTGATAAGAGTAATAATGAATAACAATGGATC
TGTTTCAGAGACTGGAATATAGATGGTTGGCTAATATTTG
CTTGTAACATACCTTTTTTTCATGTGAAAAGTTTGAAAAA
GTATGTAAACTTGAATAATGAAAAATTTTTACTCCTGTAG
TTCATGTAATTTTTGTGACATGTCGAATTTAATTCTTAGA
TACTGTGGATAACCTGATTTTGATCCTGCATGTTTTTTAA
ACAAATGATCTGTCATTTCTATGTAGAAAAAAGAGACAAT
ATTTTAAATGATGAAGGAGTAGTTGTATTCTGTTAAGGCA
GACATTTGTCTGTCTGTATCATCAGGACACAATGGGGCAA
TTCTGAAGGATATTTTGTTTAAAATTGACATCAGGAGAAG
GAAATAATTTATTTTTATTTACTTTTATTGTATTTTAATT
AAGATCACAGCATTGTGCCAAGGTGCATAACTACTGGAAC
ACTGTTTCTTAAAGTGCTTGCAGTTTATTACACTTTCACT
ATGTCTGGGTGTTTGAATATGAATTTTTAATGCCTGTATA
ATCTACATTTAAATCTACCCTAAGGTGGTTAAATTGGAAA
TATCACAGAGTATGCAATGATAAAGGAGTGCCTCAAAAAA
TTCAATAAATCTATTACAGCAATAAACCTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations