Community Action Needed: Please respond to the NIH RFI
Transcript

magoh-201

ID
ZDB-TSCRIPT-090929-11172
Name
magoh-201
Previous Names
  • magoh-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028720 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028720|OTTDARG00000022331|ZDB-GENE-041216-1 magoh|OTTDARP00000023482 CH211-216K22.5-001 LG_ BX927144.24 Danio rerio protein_coding KNOWN, 734 bp
AGCATCACTGGTGTGCGACTAGGAAGTGATGTCACTCGGC
GACGTGCAGTTGTACGCATGCGATTCCATATTGGTTGTTG
AAGCTAAAGCGATTCATTGAAGGAACAATACTTGTGCGGT
TATTTAGATACATAGACGGTTTCTTTAATACCGCGCACAG
TTATGTCCACGAGTGACTTTTATTTGAGGTACTATGTGGG
GCATAAAGGTAAATTTGGTCACGAGTTTCTGGAATTTGAA
TTCAGACCAGACGGAAAGTTGAGATATGCAAACAACAGCA
ACTACAAGAACGACGTCATGATCCGAAAAGAGGCCTATGT
GCATAAAAGTGTGATGGAAGAGCTGAAGAGAATCATTGAC
GACAGTGAAATCACAAAAGAAGACGATGCCTTGTGGCCTC
CTCCGGACAGGGTTGGCAGACAGGAACTGGAGATTGTCAT
TGGTGATGAGCACATTTCATTCACAACCTCTAAAATCGGA
TCTTTAATTGATGTAAACCAGTCCAAGGACCCAGAGGGAC
TGAGAGTTTTCTATTACCTGGTCCAGGATCTCAAATGCCT
CGTATTCAGTCTCATCGGCCTCCACTTCAAAATCAAGCCC
ATCTAACTGCCCTTTTGCTTTTATTGTGAATGAAAGTCGT
GTTTTAGTTATTGTTTGAGCTACTTTCAACATTTGTATAT
TGTTCGGTGGTTAGTTTTTTTTTTTTTTTTTTTAATAAAA
TGTGTTCAACTGTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations