Transcript

rxfp2a-201

ID
ZDB-TSCRIPT-090929-11064
Name
rxfp2a-201
Previous Names
  • rxfp2-001
  • rxfp2a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028578 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028578|OTTDARG00000022244|ZDB-GENE-040426-1225 rxfp2a|OTTDARP00000023365 DKEY-159F4.1-001 LG_none CR555290.8,BX569785.12 Danio rerio protein_coding KNOWN, 2900 bp
GTGCAGATGAGATTCCCTTTCCAGCTGCTAGTTCATGAAT
AACATTTATTTGTGGACGTGCATGGTGATAATCCATTACA
AGACACCATGGTTTAGTCCTCTGTTAAAGCATCCATGATG
GCCACCAGGGCGATGACAGAAGGTTGCCCTCTCGGCCAGT
TTCCCTGTGGGAACATGAGTGTGTGTTTGCCTCAGGTCCT
TCAGTGTAACGGCCACAAGGACTGCAAAAATGGCGCAGAT
GAAGAACATTGCGGCGACAACAGCGGATGGGCGGATATCT
TTGATCGCACTATTAAAAAGGCAGAGCCACAGGACCTTCC
TAATGACTGCTATCTGCAGCAATACCCGCAAAGCTGTTCG
TGCAAAAAGACGGAGGTGGAATGTGTGGACGTGAACCTGC
ATGTCGTCCCCATCCTCTCTTCCAATGTGACTTGGTTGTC
TCTGAAGAACAACAGGATCAGGAATTTGGATGATTACATC
TTCTCCAAATACACACAAATGCAGAGACTATTTCTTCAAA
ACAACATCATCGAGACGGTCTCAAGCCGAGCCTTCAGTAG
ATTATTCACTCTACAGAGACTGTTTCTCAGCCAAAACAAC
ATAACCTATTTAGGACCGGGTGTATTCAGAGATCTACACA
AGCTAGACTGGCTAGTCTTAGACCACAATCCTCTTAAACA
CATCACCCGTGATACATTCATCGGTCTGAGGTCCCTGACA
TATCTGTCTATGGTGAATGTGTCTCTGATGCGGCTTCCCA
ATTCCAGTCTCTGTCAGCACATGCCTCTGCTCACTTGGCT
GGACTTTGCGGAGAATGACGTTGAGTTGCTGAATTATTCC
ACTCTGATGACATGCACAGAGCTCACAGTGCTAACATTTC
ATGACAATAATATCAAGACCCTTCCAGAAAACACCTTTCA
TTCTCTTGGATCACTGGCTGAACTAGATCTGTCCTGCAAC
AGGATTTCCAAACTTCCTAAAAACACTTTCAAGAGTTTGA
AATATCTGAAGAAATTGAACATATCCCACAATCCTTTGCT
CCATATTCACACCGGGCACTTCGATCACCTGGTGCAGCTT
CAGTCTCTGAGTCTGGAGGGCATTGAAATTCCTAATATAA
CCACCAAGATGTTTCTTCCGATGGGGAATCTGTCCCACAT
ATATTTTAAAGACTTTCAGTACTGTTCCTATGCGCCACAT
GTACGGAAATGCAAACCTAACACCGATGGGATTTCGTCAG
TGGAAGACCTGTTAGCCAGCCTGGTTCTGCGGGTGTCTGT
GTGGGTTATGGCCTTCATCACATGCTTTGGGAATCTCTTT
GTTATCGGGATGCGCTCTTTCATTAGAGCCGAGAACAATC
TGCATGCAGCCTGCATCAAAGTCCTCTGCTTTGCCGACTG
TCTTATGGGAGTCTACCTTTTCTTCCTGGGGATATTTGAT
GTGAAATTCCGTGGCGAATACAACCGGAACGCTCTGATCT
GGATGGACAGCGTTGAATGCCGAACAATTGGCTTTCTCGC
CATGCTCTCCTCTGAAGTCTCGGTTCTCCTCCTCACCTAC
TTGACATTAGAGAAATTCCTTGTCATTGTTTTCCCGTTTA
GCCATTTGAGACCTGCCAAGCTGCAGACGGTGCTGATTCT
GGCTTTCATCTGGTTTCTGGGATTTGTCATAGCAGCTGTT
CCCTTGTTAAACGAAGACTTGTTTGGGAATTATTACGGCA
GGAATGGAGTTTGTTTCCCTCTCCACTCCGATAGGCTGGA
GAAACCAACGGCCAAAGGATACTCCACTGGGATATTTCTT
GGTCTTAATCTGGTGGCGTTCCTGGTGATCGTCATTTCCT
ACTCCAGCATGTTTTGCTCCATTTATAAAACGGGCATCAA
CGCCACAGATGTGCGCAGTCGGCTACACAAGGATGTGGCT
GTGGCGAATCGCTTTTTCTTTATTGTGTTCTCTGACGCCC
TCTGCTGGATACCCATATTTTTGGTCAAAACTCTCTCTCT
GATGAAGGTTGAGATTCCAGGGACGATTAACTCCTGGGTG
GTGATCTTCATTCTCCCTATAAACAGCGCCCTTAACCCCA
TCCTCTACACCCTGACCACCAGCTTCTTCAGAGAGCAGGT
GGAGCTGCTCCTTTGCCGCTGGCAGCGTCGCTCTGCCACA
AAGAAAGACCGCAAGAGCGTCACCAGCTCCACCATCTACA
TGGAGACCTCACGAAATCCTGAATACCCTGCAAAGAATTC
TTTACCACGACTGTCTTTGGCTGACATGGACAACCAATAT
GGGTGAAAGAGCCGGAAGGTATCGTAGCGTAGGTCTATCA
TAATCATTATCTCCATTCAGACCGGAGAATGACAGGCTTT
CCTGGAACAATTTAAGTGAAAGGATGGCGCTGTGATTCCT
GCCGTTCGGGATCAGAAATGGAGAGCTCTTTGTAGACGCA
TGACTGTAGCTACACTGTTTTCTCCATTAGGAGAAGCATT
TTTATTCACTTAAGCTGAGATAAGAGCCTCAGATCCCTCC
AGCGGCCATTACCAACAGCTAAACAGCATGTCTGGCTCAC
AAATGTTGAGCTCGGCTTGTTGTTTGTCAAAAAAAAAAAA
AAACTTCTGGGGAAGTAAAACTGCAGAAACAACGCACAAG
ACTGCAGTAGCACATCTTTTAGATATCAAAAATAACTTTA
AAGCATCATTTACATGAAGGACTTTTATTTTTTAAATGTG
ATGGGTTTTGGGAATGAAGTTATTTGTAATGTATGGGTTT
TTATGCTTGCTCTGCCATGTCACAGAAAAGGCATATTAAG
AGGGATTGTCTTTGCCAACAGTGTGCAACAAAAAATGACG
ACTCAAATGAAAAGAAGCATGCAAGATGAAAAGGTGCACA
CCATTCAGCTGTATAAGATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations