Transcript

rps19-201

ID
ZDB-TSCRIPT-090929-11021
Name
rps19-201
Previous Names
  • rps19-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028534 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028534|OTTDARG00000022213|ZDB-GENE-040426-1716 rps19|OTTDARP00000023328 CH211-213B7.1-001 LG_ CR391920.11 Danio rerio protein_coding KNOWN, 631 bp
CTCCAGTGTTCAAGTCTCGCGATAAGAACCGTGACTCGCC
CCTGTTAACACGCTTAGGAAACCCTGCGCGTGCCTCTTCC
TTTTGCTGTCCACAAGCAAGATGCCAGGTGGTGTAACAGT
GAAAGACGTCAACCAGCAGGAGTTTGTCCGGGCGCTGGCA
GCCTTCCTCAAAAAGTCGGGGAAGCTGAAGGTGCCAGATT
GGGTTGACATTGTCAAACTTGCTAAGCATAAGGAGTTGGC
TCCCTGTGATGAGAACTGGTTCTACATCAGAGCTGCCTCC
ACAGTGCGTCACCTGTACCTGCGTGGAGGTGTTGGCGTGG
GCTCTATGACCAAGATCTATGGCGGGCGTAAGAGGAACGG
TGTGTGCCCCTCTCACTTCAGCGTGGGCTCCAAAAATGTT
GCCCGTAAAGTACTCCAAGCCCTTGAGGGCCTCAAGATGG
TGGAGAAAGACCCCAATGGCGGGCGTAGACTGACCCCCCA
GGGGACCAGAGACCTGGACAGAATTGCTGGGCAGGTTGCT
GCTGCAAGCAAGAAAGTGTAAAATAAACTTTTGTTGGAAA
CCAGTTTCTGTGTCTTAGTCTTCTGTCTTTGATTTTTTTT
CCCCCTCAGCATTAAAAATAAAATGCTGTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations