Transcript

lingo1b-201

ID
ZDB-TSCRIPT-090929-10944
Name
lingo1b-201
Previous Names
  • lingo1-001
  • lingo1b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028453 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028453|OTTDARG00000022162|ZDB-GENE-040912-136 lingo1b|OTTDARP00000023258 CH211-116A8.1-001 LG_ BX470207.6 Danio rerio protein_coding KNOWN, 3128 bp
CTCTCGCTCTGCTGGGTATGGCATGTATGTGAGCGGGTGC
ACTCCTGTTTACATGCATGCCTGCATCTGGGACAGACTCT
CATGTATTCTGTGGACTGTAGCTGCTCGTGCTCCACACTC
TCCGAATTTCCTGGACCCCTAGTCTGCGTGGAGGATTTGT
GTGCCGTTTTTGTTTTTCCACTCACTCATGAAATTCTTCA
AAGGCCTCCTGTGTGCCACCCTGCCACTCTGGAGCGATTC
GGATCTAAGCTGCACTCCGGCAGAATGGAATTGCCAAATT
TAGACTCCACCGCATGACGTTTCTGCAGGTTACCATCAAA
ATGGTGGCCAGAGAGGCAAGTGGGCACAGCTACCTGGTGG
CATGCTGGCAGCCCATTCTCATTCTGATGCTGGGTACTGT
GCTGTCTGGCTCTGCCACGGGCTGCCCCTCTCGATGCGAG
TGCAGTGCCCAGGAGCGCTCGGTCGTGTGCCATCGGCGAA
AGCTGATCACCCTCCCCGAGGGAATTCCCATTGACACGCG
GCTGTTAGACCTCAGCAAGAACCGCTTGAAAGCCATCAAC
CCTGAGGAATTTCTCAACTACCCACAACTGGAGGATCTAC
AGCTTAATGAGAACATAATTTCCGTCATTGAACCAGGGGC
CTTCAGCAACCTCCTTGGCTTGCGAACGCTGGGACTACGC
AACAATAATCTCAAGCTGATCCAGCTGGGTGTTTTCACTG
GCCTCAGTAACCTCACTCGGTTAGACATTAGTGAGAATAA
AATTGTCATTTTGTTGGACTACATGTTTCAAGAACTCTAC
AACCTGAAAGAGCTGGAGGTGGGGGATAATGACCTGGTGT
TCATTTCCCACAGGGCCTTTCATGGCCTCAGCAGCCTGGA
GCAGCTTACAATGGAAAGATGCAACCTGACCTCTGTGCCC
ACAGAGGCCTTCAGTCATCTTCACAACTTGCTGACCCTTA
AGCTGCGGCATCTCAACGTCAATGTCATTCGAGACTTTTC
CTTTAGGAGGCTCTATCGACTAAAAATCTTGGAGATAGCT
AACTGGCCTCTCTTAGAATCCTTGACCGCAAAGTCCCTGC
ACGGGCTGAATATCACAACTTTGAGCATCACAAACTGCAA
TCTCACTGCCGTCCCTTACGTGGCCATTCAACACCTGGTG
TACCTCCGCTTTTTCAACCTGTCCTTCAATCCCATTGAGG
TTGTGGAGGGCAACAAAATGCACAATTTGCTGAGGCTCCA
GGCGTTTCACTTAGTTGGGGGCCGGCTAGTCAGCATTGAG
CCCTATTCATTCAAAGGACTCAACTACCTTCGGGTTCTCA
ATGTATCCAGCAATAGTCTAAGCACTTTAGAGGAATCTGC
CTTTCACTCGGTGGGCAACTTGGAGACTCTAGCTCTTCAT
GACAACCCCCTGGCATGCGACTGTCGTCTCCTCTGGGTCT
TTCGCCGCCGATGGAGACTTAATTTCAACCGCCAGCAGCC
ATCTTGCGAAACGCCAGAGTTTTTGCAGGGTAAGGAGTTT
AAAGACTTCCCGGATGTTCTCCCACCAAATTATTTCACTT
GTCAGAAGTCCAAGATTCGGGATCACAAAGCCATTCATAG
ATTTGTTGATGAGGGGACCACTGTGCAATTCCCTTGCCAA
GCAGATGGAGACCCAACTCCCATGATTATGTGGCAGTCTC
CAAAAAAGCAATTCATCACAACTAAAAGCATCGGCCGGCT
GTCTGTGTCCCTGGATGGCACCCTAGAGGTTAGATATGCC
CAAATACAAGACAATGGCACGTACACGTGCTTTGCTGTCA
ATGCAGGAGGTAATGACACCCGTTTGGCTCACCTACATGT
TCATAGCTACTCTCCCAACTGGCCCCATCAGCCCAATAAG
ACCTTTGCCTTTATTTTGAACCAGCCCAGTGATAACAGTG
CCAATGGGACTGGTGCGATGGATCCCTTCCCCTTTGATAT
GAAGACCCTCATTATTGCTACCACCATGGGGTTTATCTCT
TTCCTGGGAGTGGTCCTCTTCTGTCTGGTGCTCTTGTTCC
TGTGGAGTCGAGGGAAAGGCAATGCCAAGCCAAACATTGA
GATTGAGTATGTGCCACGGAAAGTAGATGGAGAAAACAGC
CCGAATGAGGGATCTCACAAGATCAGTATGAAGATGATAT
AAAAGACTAATCGCCATTGTGTGTGCATTACGTGAATAGG
TGTTCTTTACAACAGACTTACATTGAGGGAGGAAAGAGGG
CGTAATCCTTGCAATGGAATTGTGAAAAGAACATTGTTCT
GACAAAAGCCTTTTACATTTTTTTTACAGACTGTACAAAT
AAAAAAGATCACACAGGGATTGAGTCCTCAAAGGGAAAGC
AGACAGGTCATTTGAAGGTTTCAAAATTCTGTGTATTCGT
TCGGGTAAGTGTTGAAAAACATAGTCCTGTTGAAATTTGT
GCGAATGCCAGAATCCAGAGGACCAGTATGTGTCTATACT
AGTCCTCTTGTCTCTTTTTTCTGTACATAACAGTTTCGAT
GTACATCGGGCAATACAGTGGTTGAATGCAGCCAATCAGA
GGTTATGGGTTGTTGTTGAGCCTACTGGAGTGCATGTGCT
CTATCTAGATACATGCAAATGTATAGGTCAGATGAAATCA
CTGTAAATGTCCATTACCAACTCTTTATAAGAGATCAATT
TGTTTAAGATGATTTATTGATTAGGCTTGACAATCATTAA
TATCTCAAAGGTCAAGTAATAATCATTAAATATGGTTTGA
TGGTGCAATTTCAGTTTTCACACCTTACATAGTACCATAA
AGCCAGATGTAGCGTTGAATTTAAAGCCATTCGCTTTTAC
TGAACATGTGACAAAATTATTGGACCTGTGGTTGTACACA
CACTAAACTACTATTCCATCTGACAAATCTCCTCAGTTTT
ATTCACCCATTGGTGAAAAGTTTACAATTTTATTGATTTA
GTCATCAAAATGTCGTCAATTTGCCATGCTATAATGCATT
CTCTACCAGTCTCAAGAGGCGGGCGATGCTCGCTAGGTAA
ATGTGCTCTACAACCCTTGAAACACTTACAGTGCTGATTT
CGGGACAATGGATGGCTGTAAAACATATTAAAATGACAAG
CTTTTATA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations