ZFIN ID: ZDB-TSCRIPT-090929-10834
Transcript Name: pip5k1bb-201
Previous Names: pip5k1bb-001, zgc:92316-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028336 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028336|OTTDARG00000022082|ZDB-GENE-040912-141 pip5k1bb|OTTDARP00000023168 CH211-204D2.2-001 LG_none CR847826.13,CT025876.15 Danio rerio protein_coding KNOWN, 2743 bp
GTGACTTCTGTCGCCTTCATTAACCATTCCACAAAGTAGA
GAGGGACACTGAGTACACTTACCTCTAGTGTGCGAAACAT
TACAGCCTCTCGGAATATCAGAGTACACCCAAATCTCTCC
CTCTCTCTCAGGAAGCAATACAGACCTGCATCCCAGAGGA
CAGGAGGAACATCATCATTGTGAGCTCCACTTGTGCTTTC
TGGTCCACATGACTGCGCAATGCAGCAGCGCTGAACCAAA
CACCAACACCTGTGCTCTTGGTTAAATCAAGATGTCATCA
GCCAATGCCAATGGAGTCGGGAGCTCTGGAAATAACCGTA
GAGAAAAAACATACAAAAAGACTACTTCATCTGCTCTAAA
AGGAGCCATCCAGCTCGGCATCGGCTACACCGTAGGGAAT
CTGACCTCAAAACCTGACCGAGATGTGCTCATGCAGGACT
TCTACGTGGTGGAGAGTGTGTTTTTACCCAGTGAAGGAAG
CAACCTGACACCAGCACACCATTATCCAGACTTCCGGTTC
AAGACTTATGCGCCACTGGCTTTCCGCTACTTCCGGGAGC
TGTTCGGGATCAAGCCGGATGATTATTTGTACTCCATTTG
TAAAGAGCCCCTGATTGAGCTGTCTAATCCGGGCGCCAGC
GGCTCGCTCTTCTACCTGACCAGCGACGATGAGTTCATCA
TCAAGACTGTCCAGCACAAGGAGGCCGAGTTCCTGCAGAA
ACTGCTCCCTGGATACTACATGAACCTCAACCAGAACCCC
AGGACGCTCCTACCCAAGTTTTACGGCCTGTACTGTGTTC
AGTCTGGAGGAATCAACATCCGTCTCGTGGTTATGAACAA
CGTCCTGCCGCGATCAGTGAAGATGCACTACAAATATGAC
CTCAAGGGCTCCACATACAAGAGACGGGCGTCACGAAAAG
AGCGGGAAAAGCCCTGTCCCACATATAAGGACCTAGACTT
TGTGGACATGCATGATGGCTTGTACTTTGACCCAGAGACA
TATAATGCCCTGATGAAGACACTACAACGGGACTGTCGGG
TGCTGGAGAGTTTTAAGATCATGGACTACAGTCTCCTGCT
GGGGGTTCATGTTCTGGATCAGAGTCACAGAGATGGAGAC
GGCAGTGCTGTGGACGGGAAGAGAACTGTGGGACAGAAGG
TGCTTTACTCCACCGCCATGGAGTCCATTCAGGGAGACGG
AAAAGCAGCAGAGGCTTTGACCACAGACGACACAATGGGA
GGCATTCCTGCAAAAACACACAGGGATGAGAAAGTACTTA
TTTTCCTAGGCATTATCGACATCTTGCAGTCTTATAGATT
CATCAAGAAGCTGGAGCACTCCTGGAAGGCGCTGGTCTAT
GATGGCGATACTGTGTCTGTGCACAGGCCGAGTTTCTATG
CAAACAGATTTCTCAAGTTCATGAGCAGCCGAGTGTTCAG
AAAGAATCAGCCAAATCGCTTCTCCCCGAGCAAGAAGGCG
AGAAACTCCATATCGGCCCTGAAATGCTCTTCCCAAGAGG
TGCTGTCCTCACAGAAAGAGGAGAAGACCGAGGAGAAGGC
CGACAGACTTGGAGGAGCACGCAGTCTGGCCAGTCTGGAT
GGACAAGTGCTCTGGTCCTATAACCGTCCTGACCTGGTCC
TTCAGACTCCTCACCCGTACGAAGCCTCTTCCTTCAGTCA
CACCCTCTCCCCGCCCTCTGTTTTCATCAAAGATCATTAT
CTGGAAGCCAAATCTAATGAAAGATGCGCCTGCTCGACTT
TTACACTGGAGGACAGCGCCATCTGTCTGACATCCGAGCA
GAGCACCATGGACATCGACAGAGATGACGACTCCGTGCTC
GACGTCTACTTTTGAGAAGCACAATGGGATGATGGTTCAT
CTCTTGCTCTCCATCTCCTGCTTCAGTAGTGGTCTGATAC
CCATGTGTGGAGAGCTCCTCCTGCTGCCAAACACACCAAA
CAACAAACACATCTGCCAAAACCACAGCTGCAAACACACA
AACATCTCATCGCAATCCCAAGCACATTTCCCTGAAGCGT
TCAAAAACGACTGCGGATTGATGGAACCAAACGCTGACTG
TGCTTTTCTGTAGCAGCAGATGAACCCTAAATATAAAGGC
AGCTCTGGGATCAGACTGAAGACTCTTTTTGTTTCAGAGA
AAGGCAATAAGTTTGTTCCTCTGAAATACAAATGATGGTT
TCTAACAGCTTATCCTCTAGTTTTAGTGACCTCGATGCAA
AGCTTGGCGGCAAAGCAGATTTTTAAACGTGCAATTTTCA
TACATCGTGCAAAAGTGTGTGTGTTTATGATAGTTCTCCT
CACTGGAGTGATAATCATTTTATTTTTTAAAGGAAAACAC
ACATGGATGTGTGATTTACGAGCACAGAAGTGTCATGTAC
TGTAAATGTAGGATTTCTGCCAGTTTATCATCAGCTCCTG
ATAATCAAGAGTGAGACTGGCATCAGCAGTGCGTCATTTA
CAAAATATCCAGATGCCAGAATGTTTTTAATGTGCTAAAA
CGCTGATATTTTACATGGGTTTGGCGGAGTTTCGTACAGT
TTCTCTCTCAGGAGATATTTTCCTAGAGGCGTCCAGATGA
TCGCTTGATGTTAGATGATATATTTAGTGCGCTTCTGATT
TTAAATGCCATGTCTTTTGAATTTTATTATTATTATGGTT
TGTTATTATTGCACATTTGTTTGTTTTGAGGCCATAATTT
ATTAAATCATTATTATAAATGAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pip5k1bb-201 Contained in:
[BAC] CH211-204D2 (1), DKEYP-118A9 (1)

Genome Resources: Vega_Trans:OTTDART00000028336 (1),  Ensembl_Trans:ENSDART00000008215 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC081646 (1) 2680 nt
GenBank:CK698066 (1) 808 nt
GenBank:BI317932 (1) 469 nt
CITATIONS (2)