Transcript

slc39a13-201

ID
ZDB-TSCRIPT-090929-10808
Name
slc39a13-201
Previous Names
  • slc39a13-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028309 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028309|OTTDARG00000022066|ZDB-GENE-030616-17 slc39a13|OTTDARP00000023149 CH211-150G13.2-001 LG_ AL929252.6 Danio rerio protein_coding KNOWN, 1580 bp
AAAGCACTTCCGGTCGGTGAGACGTGGCTGACTGGAAAAT
CTTCGAGGAGTGAAATCAGCCTGTGCTGCAGACAGAGCTC
CAGCTCAACAGCAGCAGTAGCAGCGCCTGGATGGCAGGGT
CTAGCCGGAGAGAAAACTGCAGGAATTACAGCAGGCATCC
ATGTATCTTCCAAGTGCTTTGCGGAGGTCTGGGCTGATGA
GCGCAGGACCAGAGAGGCCCGTTTGGGCATTTGCTGTGCT
GCTGCTTGGCGCTGCCCTGCTGGCATCATCCTTTGGAGGG
AAGATGATGATTCAGACAGCTGTGGCCCAGGCAAAGACTG
CACCTGCAGGACCTGGACCATGGAGCATCAAGGACCTTGT
AGACCTCCAATACCTGGATGAGCTCATGTCCATTGACAAC
CTAGATGTTTGGTTCTGCTCCCTTGTGGGATCAATTGCCA
TTGGACTCAGTGGCATTTTTCCACTTTTAGTCATACCCAT
TGAAGCTGGGACCGCCTTGAAAACTGAGGCTGGGTGTCAG
AAGCTGAAGAAGCTGCTGAGTTTTGCCATTGGTGGCCTTC
TAGGAGACGTGTTTCTTCACCTCCTTCCGGAGGCCTGGGC
TTACACTTCCAGTCCTGGTGGCTCCCACAGACATTATTGT
ACGCAAGGTTTGTGGGTGATAGGAGGTCTGATGTCTTTTC
TGACCTTGGAGAAGATGTTTCCTGATGAAGTCGGTGATCC
AGAAACCAAAACCTCCTTCCAAAGAACTACATCCTCTTCA
TCTGATCTGAGCAGCCAGTTCTCTGTGTCCCCGCAAACGA
ATGGCATCTGCTCAAACAACAACTCCGACTCCAAGCCAAA
GACTGACATCAGCCCTTACACACCGCCAGAGAAAATAAAG
ACCAGCGGTTATCTAAACCTTCTTGCTAACTGCATTGATA
ACTTCACTCATGGGCTAGCAGTGGCAGGAAGCTTCTTAGT
AAGTCGAAAGGTTGGCTTCTTAACAACGTTTGCCATTCTG
CTTCATGAGATTCCTCATGAGGTGGGAGATTTTGCCATTT
TGCTGCGAGCAGGCTTTGACCGGTGGAAAGCTGCCCGTAT
GCAGCTCTCCACAGCATTAGGGGGAGTCCTGGGGGCCTGC
TTTGCTCTTTGCTCTCAATCACAGCATGGGGCAGAGAACG
CCACTACCTGGATCCTGCCCTTCACCTCAGGTGGCTTTCT
CTACATTGCCTTGGTCAATGTGGTTCCTGATCTTCTAGAG
GAGACCAACCCAAGGAACTCTCTTCTGCAGGTTCTGCTGT
TGTTTTCTGGGATAGGCGTCATGGCTCTGCTCTCAATCGC
CATGGACTAGACACAGGCAAGGTCTGCTTTTATCAGGGGA
CATTTATAGTGCAACCTTGCATTCCTGAGGACTTTTGGAT
TATTCACTCCACAGTTTGAGCTTTAATAATTTAGACATTT
TTGTCACCCTCCCAAAGACCAAGTGAGGAAATGCTAATGA
AAGAATTGGCCTTGACAGTTTGGTGCTTGAATCTGCCAGT
ATATGATTTTAAGCCTTATATTTCACACTCCAGATTAAAT
TTGAACTGAAAACAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations