Transcript

mboat1-201

ID
ZDB-TSCRIPT-090929-10720
Name
mboat1-201
Previous Names
  • mboat1-001
  • zgc:101798-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028206 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028206|OTTDARG00000021997|ZDB-GENE-041114-98 mboat1|OTTDARP00000023069 CH211-160K2.1-001 LG_ AL935025.11 Danio rerio protein_coding KNOWN, 1834 bp
AGTTTGTCTCTTCATCATGCTGCGGTTCTGACATAACGCG
ACATTTTCACCCGTAATGTTTACAGCCACGACGTCGCTAT
TTGTGAGGTGATACAGTGATTTATACAATGCAGAATGGAC
AAGAAGAAAAACATAGACATTGCTTTTAAAACCACTGGAT
GCACTTGGTTAAGTCCAGTCAGCGATCAGGTTGGAGTTCC
TTTGGATCAGGTGAATTTCATTGCCTGTCAGCTGTTTGGA
TTAGCAGCTGCATTCTGGTTTCGCCTCTTTCTCAGTCCCC
AACGTGCCACTCCTGAGGTCCGACATGCGGTCGCTGCCAT
CCTTGGAGCTTCGTCTGTCATGTTTTGCTTTGGCTGGTAT
GCTGTACATATCTTCATTCTGGTTTTGGCTTGTTATGGGA
TTATGATTAAAGCCAGCGTCCGCAATGTTCACAGATATAC
TATGGTTGCATCAATCGGATACCTAACAGCTTGCCAAGTG
AGCAGAGTGTTCATATTCGACTATGGCATCCTGTCCACAG
ATTTCTCTGGCCCTTTGATGATGATCACACAGAAAATCAC
TAGTCTCGCCTTCCAGGTCTATGATGGTATGGGTCGAAAG
CAAGAGGAACTGAAAGATGATCAGAGGCAGCTGGCTGTAC
ACTCTAAGCCATCGCTGTTGGAGTACCTAAGCTACAATAT
AAATTTCCTGAGTGTCTTGGTGGGTCCCTGTAGTAATTAT
AAAGACTACGAAGAGTTTATAAAGGGCCAGCATGTCCAGC
ACAGGCTGAAAAGAGTGAAAGACGGCAGCTTGCAACAGAA
CGGCTGGGATAAAGTGCCTGAGCCATCGCCTGTGAGGACT
GTGATTACGAAGGTTCTTGTGTGCGTTTGCTGTCTGCTCT
GGTTCTTTATCATCACCCGGGCATTCCCCATAAAGTACAA
TGTGGACCCACAGTTCATCACGGAGGCCTCTTTCATTAGC
AGACTGGCTTATGCCTTTGTATCCATCCAGGCAGCCAGAC
CCAAGTTCTACTTCGCATGGACGCTTGCGGATGCAGTACA
TAATGCAGCGGGTTATGGAGTCAGCGGTGTGAATGAGAGA
GGAGAAGTGTCCTGGGACCTTGTCTCCAACGTTCGCATCT
GGGAAATTGAGACAGCGACGAGTTTTAAATCATTTATTGA
CAACTGGAATATACAGACGGGTCTTTGGCTGAAAAGAGTG
TGTGCGTTTGTGTGTTTATGCGTGTGTGTGTGTGTGTGCG
CGCGGGGTCGCCTTTGTGCAAACTGAGAGAGCAACGACAT
TGACGGACAAAGGCTACTTTGTGTGAACACAAAAAAAAAG
CTGGGCCTCCGCTTGCTTACAGGCAGTTCACAAACACACA
CAGACTAAACCTCACTAGGGATGCACTCCATTGAAAAGAC
ACACACATAAGCAATGATTTCATGAGAACAAATAAGGGAA
CGCACAGTTTGAGATTAAGTCCTAACAAGGCAGCTATTTG
CAAGATTTCCTAAGGAAAATGAACGCTGCCCATTTTAAGC
GTCTTTTAACTAGTTTAACACTGTATGCTAGAGAAGGAGG
TATCCTTAATTGTACGTCGTTTGCTAATTTATTTTGGATG
TAGTTGTGGTACTGATGCTGAGAGTTGAGTGAGGTTTTTA
TAGAACTGAATATTAATGTGCAGACAGTAACTTAGTTTTG
TGGTGTAAAGACGTCTGTTGTGAGTATGCAATGCGTAACT
GCTGTGAAAAATGAATGAAAGTAGTACTGCTGCAATATTA
ACTGACGAAGAATGGAATTAGAATTATATGTGTTGTGGAT
GGTGATACTTAAATAAATGTTACAGTTTTTAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations