Transcript

ndufb5-201

ID
ZDB-TSCRIPT-090929-10687
Name
ndufb5-201
Previous Names
  • ndufb5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028173 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028173|OTTDARG00000021977|ZDB-GENE-011010-1 ndufb5|OTTDARP00000023042 CH211-201H21.4-001 LG_ AL928701.7 Danio rerio protein_coding KNOWN, 858 bp
GGTGTTCACGCACTCCCTCAACAGTCATGGTGGGCATGAG
CATATTCCGCTCAGCGGCTGCTTTTACAGCCCGATTAAAC
CCGCTGAAACGAACATCTCAGTCTTCAAATCTGCTTTCCA
GGGCCGTTGCACGTTCAGAACAAGTGGTTGTCCGTCATGG
GAGCCATGGTAAACGGATGTTTATGATCCAGCCCTCATCC
TTCTATGATAAAAGGTTTCTTAAACTCCTGAAGTTTTATG
TCCTTCTCACTGGCATCCCCATGGCAGTGTTTGTGACGAG
TGTTAATGTTTTCATTGGAGATTGTGAGTTAGCAGAGACT
CCTGAAGGCTATGAACCAGAGCACTGGGAATACTACAAGC
ATCCAATCACCCGCTGGATTGCTCGTTATGTTTATGACAG
CCCAGTAAAGGATTACGAGAAAATGTTGGCACTTATCCAG
ATGGAAACAGAGAAGGCTGAAATGAGGAAAATGCACAATG
AAGTTCGCCAACACATGAGAGAAAAAGGAGATGGACCCTG
GTTCCAAATTCCTACGATTGATAAGGAGCTCATCGACAAC
AGCATCAAGTCAACCCCTGATAATTAGGAGGGTTCATGTA
GACCTGTCCAAAATATTCAGGCATTATACAATGTATAATG
TTATGTTATTATTAGAAATGTCTTTTCCTTTTTCTTTGCC
TCGGGCACTAATAAACTAATTATTATAAGTGACTGCTATT
GTGTATTGTTTAAGTTGTTGCCGTTTACCCCAAAACGGAA
ATTCTGTCATCGCTATTCATTTTAATCTGTTCAGTACAGA
ATTTATCGCAGTATGGCAGCAGACCAACTGGAAACCTATA
CAGACATTGTTTATTGAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations