Transcript

klf7b-202

ID
ZDB-TSCRIPT-090929-1065
Name
klf7b-202
Previous Names
  • klf7b-001
  • klf7l-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000007860 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000007860|OTTDARG00000006989|ZDB-GENE-041014-171 klf7b|OTTDARP00000035310 DKEY-101C24.1-001 LG_ CR381621.5 Danio rerio protein_coding NOVEL, 6011 bp
GAGCCCAGCAACTTGCCTTGGTGATCCACGGCATTCAGGA
GAAAGGCTACCTGGAATTTATAGCGCAAAAGACACAGAGG
CAATGCGGAAATAGGTGGACACTTCATGTCACCGAGTTTG
CATCCCACTCCCAGGCTGAGGATCTGAGAGTTCGCGGGGA
CTGCAATTAAGTGACAAGAATTGTTTTTTATTTTTTCCTT
CCTTTTTTTTCCATTAGCGCTTAAAACAACCAGCTTTAAC
TACACTTCACGGAGGATTTGAAGCATTCCTTTTTGCGTCT
GACAGCGGGCTGAGAAGAAAACAATTTATACCTGAGGATC
AAAGCATCAGTTTTGTTTTTCTTGTGAGCATCAACATGGA
CGTGTTGGCGAATTACAGTATTTTTCAGGAACTTCAGCTG
GTGCACGACACGGGCTACTTCTCAGCGATGCCGTCGCTGG
AGGAGAACTGGCAGCAGACATGTCTGGAATTGGAGAGGTA
CCTGCAGACAGAGCCCAAAAGGCTTTCAGAACTCTTTGAT
GAGGAGCTCGACTGCCTTCTTACGCCAGCATTCATGAAGG
GAGACAGCGACGAGGACTTGATGGACCCTTTGCTGCCCAG
TTTATCCGACGAGCCTAGCCCCCCACCTCTGCTTGTGTCC
CTTCCCAAAACCCTCCACACCCCAGCCAACACTAAGAGTA
CTGATGCAGGGCTCAAAGAAGCCAGTGGAGGGGTTAATCC
AGCCCAGTTAAATGCAGTCACGTCCCTCACGCCACCTTCT
TCCCCAGAGTTGGGTCGCCATCTTGTTAAGCCCACACAGA
CTCTTACCGCCACAGCTGATGGCACACTCACACTAAAACT
GGTGGCCAAGAAAGTCGGCCTTGGAGCGGCAAAGCTGGTT
GCAACGCATTCGATACCTTCACCACCAAATCGTGGCACAC
AGAGTGATGGCGAAGGAGGACTTGGTACAGTAGGTGGAGG
GGACATCCCAGAGAACAAAAAGAGGGTCCATCGCTGCCAG
TTTAATGGCTGTCGGAAGGTTTACACAAAAAGCTCCCACC
TGAAGGCACACCAGAGGACACATACAGGTGAGAAGCCTTA
CAAATGCTCCTGGGAAGGCTGTGAATGGCGTTTCGCACGA
AGCGACGAACTGACGAGGCACTACCGCAAACACACTGGTG
CCAAACCTTTCAAGTGCAACCACTGCGACAGATGTTTTTC
CAGGTCTGATCACTTGGCTTTGCACATGAAGCGACATATC
TAAGGCAGAGGAAGACGGGAGAAAGAGAGAGAGAGAGAGA
GAGTGAGAGAAAACGAAGAGGAGAACAGGTGTGCACCATC
CAGACGGGAACATTCACAACAGACTTTGGGTGCACAAGAG
GGGTCTGGCTGCAAACGTCACCAGGAGGAACATGCAAGGC
AGCGTGGGCAAGCGTTGTTGGATTCTACACACTCTCAAGA
CAGTCCAAAAGCCTTTTCATCAGCGATTAGCCATGCCTTA
CCGAGCACTAGCTTGGAGGTCAGACACTGCCAAACACCAG
GTTTTTCTTTTCTCCCCTCATTCTTTTTTTTGTACAGTAC
AACACCACTAGCATGGAACAGGAAACTGAGCGCTTCATGT
ACAAAATGAAAACGCACATTTCATTCATCACATAGCCTAA
TGGTTCTACTGGAGAATCATGTTCATTGTACATTCTGGAG
TTTCAATTTCTTTTTCCAAGGACAGATCACAATAACCAAC
CTGCAGCTATGTTGTATACAGCAAACAACCAAACACGGAA
AGCAACATTGCCAATACGTTCTGAGGAGTGACCAATGGAA
TAAGTGGCCAAATGCAACGCCTGGCCCCGGAAGCAGGCTC
TGCCTGGGGAAAAGTGATAAAGAAAAAATACGGCAACACT
CAGGATGTGTGCTGATTTCTCGTACTCTTCGCTCAGGAGC
GAACTCTTCTCTGCTCTTCACACCCGTCACCTCACGGGTG
ACTGAAATGATGCGCAGCGACACTTTCTTGCCTTTGTTTT
TTGTTTAAAGACAGTGTTAAAAAAGATGGTTTGTTTTCCT
TCTGAGCTAAAAATGTCTTAAACTTCTGAAAGGTGAAAAT
TTGCTTTGCAAACAAGCGAAAATGTGCACATACGGGCAAC
GAGAGGGAACTTTGAGGCCTTCTCTGTATGCACAAGGTTC
AGTGGCTGCTATCTGGCACTGAAACAAAACATTCAAAGCG
TAAGACGGGAACAGAAACCCCCCCCAAAAAAGATTGGGAT
TGCTGGCTTGGTATAAAAGGACAGAAGTCTTCTGTTTTTC
ATTTTGCTTTGCACCGACTTGATCTGGGTAAAGTTAACCA
ATTGTCACGGACCTTGTGTGATGCTCTTGACACTGGAAAG
AGTTCTTTTGCTTTGTGTTGATATTGGCACCTGTGTAAGA
ACGTAGTCGTCCAGTGCACTGTAGGAGGCCAACAGAGGAG
ACGTAATGGGGGAGGGACAGTTGGCAGGACGTTGACTCTC
AGATTGGAGCACCTGCTGGGATCAGGATCCAAAAGACCTT
GGTGGCATCAGCCCAGACAAACTTTGCCTGTTTCGTATCC
ATTGTCTGCACTGATTTTTTCAATGTTCTCTGTGCTTTTT
TTCATACTGTCAAAAAAAAAAAAGCTCAAAAACAAAACAA
AAAAAAAGCATAAAAACAAAAAACATCTTGGAGGGAAAAA
AGCAGAAAACAAAAAACACATAAAAAAAACTCTTTTACAG
ACACATCACAACACAGACAGAATGGTTTCTTTGCTCTTGG
CTTTTTCCTGGAAAAAAAAACTAAAGAAAAAAATAGAACA
ATAATTACCAAGTTAATGAACAGCGTTAAAAACGAAACAC
TGCATGGCAGCCTCTTTCAGATAGATACACACACTCGCAC
ACATACATGCACAGCTTGCCTCTCAGCATTATTTGTTTTG
CACCAAAATCTTCACAGCAGGGTTTTAGCAATTGTTGTTT
TGTAGGATTGCGTTCCATCCAGACGTCAGACGTTCAATTG
AGAGCTTGTTGATACACTCGAGTATATTATGCTAAACCGG
GCCTAGGTCTAGCTTGGTGTTAACAATCAGCTTCTAAATC
GCGGGGACAAAAAAAACATATCATCATCCCCAAGGTTGTG
AAGCCTGTCGTGGCGTCGCAATCAGGGCGTTCCCTTACTG
ACCCTACTCTTCTGCATTGATTTAATGGCTGTGAGGGTGG
AGGGAAGATTACGATTCAGCAGTAACATGTTTAGAATCAT
GGCAGACTTTACTAAACGATCCCAGAGTTTCCCCTTAGGG
GACCACCGGAGCTTAATGATCAATACACAAACTCTCAGCA
TAGAAATGCTGAGTTGGTGCAGAATGAAAAGTTGGTGCCT
TTCTCTTGGTTTGAGGCCTGCTGAAGGCAGCTCATCTATC
ACATATATACACACACAAACGTACACAGACCCACACACAC
ACACACACACCATTTCTTCAGTTTGACCATTTTAGTCGCC
ATTTTCAATTGATTTCCTCTCATTCCAACAAATTTTCTTT
GTTAAAATGCAAAGTCATGCCAAAATTTTGACAAAATAGG
AGATGAATCAGTTTCTCTCCAGTAATGTACAATCAGTTGT
GGGTTGTGGCACTTTTGTCCGCAAGAAGCGGTCCCTGTGT
GTGACGATTGTTCGTATGAGTTTCTGTAAAATAAGGTGCA
TTGCTACAGTGTCATAATAGCATTGTGTACTATCCCACAA
TTTCACAAATGGGGTTATTACTGACAATGTGCAAACAGCT
AGAAAAGCTTTGAAAGGGTTACATTTCCATTTTCCTCACA
GATAGCAGTCATGAAAAACTGCTCTTCTCTCCAGTTTTTG
CTTTGACAAAAAGACAATTCTGATTCATTCAGTCACCAAA
CGTGATATAACAACAAGAACACAGGGACAAAAACAAAAGC
ATCCTGTCATTTTCTTCATCAATATATGAATTCAGCTTTC
AAATTTAACACTGAAGATACACATACTGTAACTGTCTTAT
TTTAAAATACAGTGCAAAGTGACAAATTGAAAATTACAAA
TGAAACTCTCTTCTGCCAACATGCTCCAGACTTTACCAAA
TGAATATGGAACAGGCCAATCAAATTCATTAGCAAGCAAC
ATGCCGTACATATCCGATCACATATCAAGTGCCATTCGAA
ACCCCCAATCTCTCACTCTTCGAGCGACAGCAGCGGTCTA
GTCAGTTGCACAGGCGCCTGATGCTTTGCCCAAAGATTTA
AGCATTTGCAAATAACCTGCTGGGTGTTGAAAGAGAGAAA
GAAGACTTATTTTGCATTATTCTCACAGTATCTCCTTGTA
CCCTACACCAGCTTTCTAAGATTCGTTCTTGAACATCTAT
ATGACCATTGGCTTGGTCTCGAGTGTGTGTGCTTGTAATA
TACGGTTTGAATGCAAAGTTGAGGATGAGTTTTAAGCCTA
GCCGTAAACAAACAGCGAATTAGTTGCATTGGTTCTAGCG
CTTCTGTAGTCAGTGCAGGTCACGCATGTCCTTAGAAATC
ACCATCCAGGCGAATGTTTCTAAAACACTCTTGATTCTGA
TTTAGCTGTACAGAAGACCACCTTTTCTACCACAAGTTAT
CCGTACAACTTCAAAACGGAGACAATGCTGTGGCAGAACA
TTTTACATGACAGTAGGAATGTTCGAAGACATTCTAAGGG
AACAATTTTAAGTGTACTAGATCTGGGCACTCTTCCAGTG
AAGCTCCCTTCCCAAGCCGTTTGCTTTTCAGCTTCAAAGA
GGCTTTTGGCAGCTTAAATTTTATATGAAAAAGATGCTTG
AAACATCACAAGGGGATTTTATGATAAAAGGTCAGAGGTG
ACAACTTTTCCGTTTTATTTTTTTGTTATCGTCTGTATTG
CAACAACATTTCACTGCATAAATAACACTCGTCATTGTTA
CCGCTAGCTTAGTCTGTTAAGAATGACACTGCTGTCGATT
GTCTACATAACATTTAGTGGCATTTCGAGATGCACTTATC
ACAAGAACATGGGAGCAATTCATTCTTCAGCTTGATAGAT
AAAGCTTGACAAACTTTTTCGACGCACCAAAAAGAGACTA
AATCTGCATGTACATTCGAATATTCATCCATAGGTTCCCA
GTCACTCGCAGACAGCGAAGAGACTCGTTTGTCTTGGGAT
ATACTGCATCTTGAAGTGCATCTGTATCCGTGTTTGTCCA
AACTTGATATGTCAGTGCGTAAGGTTTTCACCGGGTCTTT
CCTTTCTGCTTTTTGCGTTCCTCACCTCCCACCCCTACCT
ACCCCACCCTGCACCTGCAGAACCACAATCACGTCCTTAA
AACACAGTCACCTCAGTGTCATCCTCCGGTTACGTGTTAC
CAGCTGTCAGCGATTTCTTACCTATGAATGTCCGTAGACA
TTACTAAGCAGGGAGCAACCGGCCAACAACAGACCTCAGT
GCTTTTACAGGTGCTCTCTTTTATCCATAAATGGATCTCG
CAGAAAGCTGCCAGTTGGTAAAGCAGGTACAAATCAGAAA
AAAAAAATGGAAAAAAAGGGAGAAAGAAAGAAAAATAGAA
CAGTTATGTGCCATCTTGATTTATCTGTATGGAAGTAGGA
CGACATTTTGCCATATGTAGGCTGAAGCATGTAGTTTCTC
GCTAGAGCAGGGACCTTCATATTCACTGTCCTCTTTCCCT
CGCCACATCACTAACACTCCACCCCCTCACTTCCTGTAAT
CTTCACACTCTTCCTCTCCGTTTTGTTTTTTGTTCTATTC
TGTTCTTTCCTTGTGTGTTTTTCTTTATCGGTTCTTTTGC
TGTACAAAGTGTTTAAAATATTATTATTTGTATGATATAA
TGTTAGTATGGTAATGTTCTTTATTAAGGAAGAAGATGAA
ATTTATTTTTGTTACTGGTCTGTTTCATAATTCTTTTTTA
AATTGGTATTGTAAGATATCTATGCAAGAACTGTTCAGTG
GAGCATTTTTATTTAAGAATGTAATAAGTGTAATAAATGG
TAGAATCTGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations