Transcript

ccdc102a-201

ID
ZDB-TSCRIPT-090929-10594
Name
ccdc102a-201
Previous Names
  • ccdc102a-001
  • zgc:77294-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028063 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028063|OTTDARG00000021914|ZDB-GENE-030131-4044 ccdc102a|OTTDARP00000022966 DKEY-107K2.1-001 LG_ BX323849.10 Danio rerio protein_coding KNOWN, 3031 bp
AAAAGCATCATCTTGACGTGCATCATGGATTCCTGATAAG
ATCTTCCTGACCGTAATCTTTTTCCCTGGACTCATCATTG
GCTCAGTGATGAACCACACACCCAGTCCCCACATGACCGA
GGCCGCCAAGTCCGGGGCAGGTTTGCTGTGCGGCTTGGGC
TTGGGCCCAGATCGGGTGCGCTCTCCAGACAGCCTGACCC
ATACGCCCAGCCCGTCAGGGGGAACGCCCAGCTCCAGCCC
TCCTCTGTTGCTCTCTCCAGGGCTGGGTTGCGATGGCATT
GGGGACTGGGAGAGCCGCGAGGAGCTGCGTCTGCGGGAGC
TGGAGGAGGCTCGGGCCCGGGCCGCTCAAATGGAGAAGAC
CATGCGCTGGTGGTCGGACTGTACAGCCAACTGGAGGGAA
AAGTGGAGTAAGGTACGGGCTGAACGTAACCGGGCACGGG
ATGAAGTCAGACAACTGAGGCAACGCTTGGACGCTCTTAC
CAAAGAGCTGACGGGTGCTCGACGGGAGCGCCAGGAGCTG
GCTGCGGAAAACGAACAGCTTCGTCTCGAGGCTCAAAGGG
TCCGAGCTGAACAGAGCTCCCCAGAGAATGCATCTAATGC
ACCAGAATCAAACTCCTCCACTGCCTCCACACATTCCAAC
CAGCCAAGAGAAGCAGAGATTAAGCAGGACAACCAGGATG
AGGAGGGTGTGAGAGATGGGCCTGGCTCTCCAGAGCAGGA
ACCTGTGAGAGACATAGGCACTGACAAACTATACAAGCAG
AAGGAGATGGAGTTGTTGGAGGCTCTTCTCAGGGCAAAGT
CAGAGGCTCCAGACTCGTGGGACGGTCGCAGTGCCAGTAG
CTTGCGCTCTGCCCTCAGCCGGCAGGACAGGAACAGACTG
CTGTGGGAGGATCTGGCTGCCCTGGAGGAGGACACCAGCA
AGCTCAACGCTCTCCAACTACGCCTGGATGAATCCCAGAA
AGTCCTGCTAAAAGAACGAGAAGATAAACATGCGCTTATT
AAAAACATTGAGAAGCTGGAGGCAGAGCTGAGCCAGTGGA
AACTCAAATATGAGGAGCTGAACAAGAGCAAGCAAGAGGC
CTTGAAACAGCTGAACCTGTTGAAGGAGGTGCATCAAGAT
GAACTTGGCCGCATGTCTGAAGACCTGGAGGATGAGTTGG
GTGCCCGCACCAACATGGACAAGAAACTAGCAGAGCTTCG
TACAGAGATGGAGCGTCTGCAGGTGGAGAATGCAGCAGAG
TGGGGTCGTCGGGAGCGTCTGGAGACGGAAAAGCTGGCTC
TGGAGAGGGAAAACAAAAAGCTGCGCACCCAGATGGAAGA
CCTGGAGGAGCAGCTGGCACGCAAGCGCAGGCAGGCCGCC
AGCGCCCTGGACACCGACCTCAAGACCATCCAGAGTGAGC
TGTTTGAGAGGAACAAGGAATTGGCAGATTTGCGGCACGT
TCACTCCAAGGTGAAGAAGCAGTACCAGGAAAAGATGGCC
GAGCTCACACATGCTAACCGGCGTGTAGAGCAGCATGAGG
CAGAAGTGAAGAAGCTGCGGCTCAGGGTGGAGGAGCTGAA
GAAAGAGCTGGGCCAGGCTGAAGATGAGTTGGATGAGGCC
CATAATCAGACCAGAAAGCTACAACGATCCCTGGATGAGC
AGGTGGAGCAATCCGAGAATCTACAAGTTCAGCTGGAACA
CCTACAATCCAGGCTAAGGCGTCAGCAGAACCCTGGCCTC
TTTGGCAAAATGAGGACATCAGCTTCATCACGTTTTGGCC
CTGAAGATGCAGACGGCCCTCCTAGCGACCCTGATGAAGA
TGAGGAAGAAGAACTGCAGCTCCAAATCCCCTGAACCCTT
CACTGCAGACCTGGGAATGACTGAAGACTCACCGATCTCA
CTCGAGCATTTCACCTTCCCCTTCATTTCATCTCTCAGCG
AAATCTAGAAGAGGACTTCACGACCCTCAGCAGACAGATA
AACACAATCCTTTTTCAGTAGCCTATAATAAATGTGTGCC
AGGGCCAAAGTACTGTCTGAAGCCTAAGAAAAACATTGCT
GGTTCTAGTCCAAGTTGGCACATAGGTTATTGATAGACAA
ATATCAGACCCATTTATTTGACTTTTGAGGGTCCATTTGA
AGCCTAGTGATTCCTATTATTCACATAAGCAGACACATGT
GCTGGCACACATTGTAAACGCATTAGAGCGTCCTCAAACT
TTCAGACATCAAAACCATCTTGAAACATTACATTTCATTT
TAATCCCCCATCTGACCTCTAAAAGAAGCTGTTTATTCAC
ACAGTTCTTCTTCATCAACCGTTTACATGCTCATTTCCCA
ACTTTATTCCTCATCACCTGGATTTTGATTTATTCTTGTC
ACCCATTCATTTCCACCGTTCCCATTTTACTCTTCCTATT
CATTTTGATTTTCTATTTAATCTTTCGCCAGCCCTCCCAC
CCACCCCCATCCCTCAACAGCAACTCTCACATCAATATTC
AAAACAACCCATTCAGAACATGATGATTATGTTCCTTGTG
TCTGGGGAACATTTCATTTCTGCTGTGTTGTTACTGAAGA
GGCAGGCGAGCGCTTTGGTTTTTGTTCTCGCCAGTATTCC
TGCGTTAGTTGTCCCAAAGTTTTTTCTTGGTGACTATATT
AATGTGTTTCGGTCTTGTTTTATATAGGAAGGAAGGGAGG
GGGTGGGGGATCGTGGGTAGTTTGTAAACGAGTCTGTTGG
ATTCTTCTTAAATACATACAAGCATAATTGCTTCGCCCTT
TTGCGTTCAACCTATAGAAAGGTGGCTGGTGCATGAGGGA
ATGTTTTAACAAATGGTCTGTTGATTTTAAAGAGATTTTT
AAGCAATATAATACTGTATACGTCTGCAATGGGGACCAAT
CTTGACTCATCTTTTACTTGGACATTTGTATGGTCATATT
AAAGTATTTATCAGATGTTTGTTTTTTACCTAAGTGGCCT
GTATTGCAGTATTTTGTATTTGTTTGTGTTTGTATTTTAT
CTCTATAAATGTTAAATGTATATACAGTAAA

Segment Relationships
Protein Products
Supporting Sequences
Citations