Transcript

zgc:113278-201

ID
ZDB-TSCRIPT-090929-10541
Name
zgc:113278-201
Previous Names
  • zgc:113278-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028008 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028008|OTTDARG00000021878|ZDB-GENE-050327-66 zgc:113278|OTTDARP00000022919 CH211-10D23.2-001 LG_ AL954866.11 Danio rerio protein_coding KNOWN, 1568 bp
CCTTTGTAGGGCGCTTCAGAGCTTCCGACACAGATCGTAA
GCGGGTGTGAATGTAGTGGGGCTTTCATGACAGAATAGTG
TGAATTTGCCCGAGATCTGCTTTTTCCCTGCGAGCCTCTG
CAGTGACCAGGAGTGATTAATAAGAGCGATGGGCTTCCGC
AAGAAGAACAAGAGTCCGCCGGTGCTCAGCCATGAGTTTG
TCATCCAGAATCACGCGGATATGGTGTCGTGTGTGGCCAT
GATCATCCTGCTGGGACTCATGTTTGAGGTCACAGCCAAA
TTTGCCATCATGTTCATCACAGTGCAGTACAATGTCACCC
AAAGCCTGGATACTGATGTGGAGGACAAGCCTGACCCTGT
GAACTTCTACAAGTATGGCGCCAAGGACATCGCAACCGTG
TTCTTTTACCTGCTCATCGCTATTATTCTCCACGCCCTCA
TTCAGGAGTACATACTCGACAAAATCAATCGTCGGCTCCA
CTTGTCCAAAACCAAACACAGCAAGTTCAACGAGTCTGGA
CAGCTGGCCACTTTCTACCTGTTCTCCTTCATCTGGGGCT
GCAGTATCCTCACTAATGAGGATTTTGTGATGAATCCAAC
TTTCCTTTGGGAAGGATATCCGCACATCCACATGGCTTTC
CAGGTGAAGTTTTTCTACATCTGTCAGATTGCCTACTGGT
TTCACGCTCTTCCTGAACTGTATTTTCAGAAAGTACGAAA
GGAAGATATTCCACGGCAGCTCTACTACATTTGCCTTTAT
ATATTCCACATCACTGGTGCCTACGTCCTTAATCTCCATC
GTTTGGGTCTAGTCCTTCTGGTGCCACATTACCTGGTGGA
GCTGCTGTTTCACGCCTCACGACTCTTCTACTTCAGTGAC
GAGAACAAACAGAAAGGGTTTACGCTGTGGGCTCTGCTGT
TCGTCATCACCCGCCTCCTGACGCTCACCGTTTCTGTTTT
GACGTTTGGTTTTGGCCTGTCTCGCACAGATAATCAGGGA
TTCTCCTTAGCAGAAGGAAACTTCAATGTGCTGACTGTCA
GGATGACATGCCTGTCAGCCATCTGCCTGACCCAGGCCTG
GATGATGTGGAAATTCATCAACTTCCAGCTCAAGAAGTGG
AGAGAACAATCTCAGATCCAGGCCAGCAAGAAGAAAACGG
TCAGTCCCAAAAGCAGACCCAGCAAGAAGGAGTCTCGTGG
GGGTTCAGTCAATGGAGTCATGAAACCGGACGACAAGACA
TCGCCGAGAGCAAGGAAATCGAAAGCGTCGTAAAAGGAAA
CAAGACAGGAGGTTCCCGAAATGTGATGCTCTGTTTCCAC
TCTACATTTAGATTAGAAACGGATCGATAACTGCGAATCG
AACCACAGAAACAAACCAAGGAACTTGGTTGTACCACATG
GTTCAGGTGATAGTCCCCCCCCCCAAAGTTTTTCCCTGTC
TGCATCTTAAAATTGAACTCTAGTTTTCGAATCTTTCTTT
ATTCATTTTGATCATTAGATTGAGAGGTTTTCTGAAGGAC
TATAAGAGATGATGCACTGCGTTACAGATCCCTCACTCAT
CGATTTGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations