Transcript

srrm2-201

ID
ZDB-TSCRIPT-090929-10453
Name
srrm2-201
Previous Names
  • srrm2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027916 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027916|OTTDARG00000021820|ZDB-GENE-050522-399 srrm2|OTTDARP00000022845 srrm2-001 LG_none CU459155.7,BX571714.7 Danio rerio protein_coding KNOWN, 4519 bp
AAATGAGCGTTACCTGTTCGTTCTAGTCAACGTTGCGCAC
ATCGTTTTAATCTTACGAAGATTCTTTGAGACAGATTCAC
TGGGTTTTCTCTCATTGTGCCACAGTTATCCGGTCTTTGG
CCTGCAACGGTTCTACTTTTGTTCTCTCCCTGAGCGGGAT
CACAGAGAGCAGAGATGTATAACGGTATTGGGCTGACCAC
GCCGCGAGGCAGCGGCACAAATGGCTATGTTCAGCGTAAC
CTGTCCAGCATACGTGTGAAGAGGAACCGGGATGAGCGCG
GAGGAGAGCGAGATGAGAAAGACAAAGAGAGACTGGAGAG
CCAACTGAACAGACAGCCCAATGCTGATATCCTGGAGCAC
CAGAGGAAGAGACAGCTGGAGGTGAAGTGCGCTGAGCTGC
AGGACATGATGGAGGAGCAGGGTTACTCTGCAGAGGAGAT
TGAAGAGAAGGTCAACACCTTTCGTTTGATGCTGCAGGAA
AGACAAGAACCTGCACCTCCTCCAACAGAGAAGACTGCTG
TGACAGAGACTCATGCTCTGGCAGCCGCTAACCAGCAAAA
AAATGACCGCCTGAGACAAGCGTTCGGCATCAGCTCTGAC
TATGTTGACGGCTCATCCTTTAACCCTGACCGGAAGGAGC
GAGAAAAGGAGAAGAGGGAGCAGGAGAGACTGGAACGAGA
GAAGCAGCAGCAGCAACAGTATCAAATTATTGAGTCTGAT
GACTCTGATTCATCTACTGAGCCAAAAAAGAGCCGCAAGA
AGAAGAAAAAGAAAAACAAAAGTAGAGAGAGCTCTGAAAG
CCCCTCCCCATCCCCTCACAGAGAGAAGAAAAAGGACAAG
AAGAAGAAAAAGAAAAGGGAGGAGTCAGTGAACAGTGACA
CTGAGAGCAGTTCATCAGATGAAAAAGAAACATCAAAAGG
AAAGAGAAAAAGGAGCGACAATGAGGCTCCACCTCCCAGT
AAGAGCCGGAGACGGCAGAGTGCATCATCCAGTCCAGCTC
GCAGCCAATCCCCTCAAAGAGGGAAGCAGCAGAAAAAAAC
TGATTCTCGTCCAGAAGAGGTGAGGAAAGGAAGATCCCCT
GACAGAAGACGCCGTGGTCGCAGTCAAGAAAGTCCTAAGA
GAATGGAAATCAGAGAGAGGTCACCAAGACGCTCTAGAAC
ACCTGAGCAGAACAAAAGATACAAAGGTCGAGAGCGTGAG
AGAGAACAACTACAAGAAAAACCTCAGAGGAAACGTAACG
ACTCTTCATCACGTTCTCCACCTCCGAAGCAGCAGCTGGA
CAGACGCCCAAGGAGTGAAGAGAGAGAGAAACCCCCTCAA
ACAAGAAGACATGACTCCTCTTCACCATCTCCACCACCAA
ACAAGCAGCGGCAAGACAGAAGACAAAGGAGTGAGGAGAG
ACTGAAAGCCCCTCTGCGGAAAAGGCCTGACTCTTCACCC
CGATCTCCCTCTCCTAAGCAGCAGAGAGACCGAAGGGACG
ATGGGAAGAAGAACAAAGTTCAAAGTAGACATGACTCCTC
CTCCTCATCATCAACATCATCGCCATCCCCATCTCCTTCC
CCACGTAAAGACAGAATGAGAAGAGGACACAGTGGAGAGA
AAGCGAGAGCTCCTTCACCAAGAGACAGAGAGAAAGAGAG
GGCAAGAGGAGGGGAGAGGATTAGCGACAGGGATAAAAGC
AGAAAAGAAGACAGAGGACGAGATGGTGATAAAGCAAAGG
AGCAAGCTCGAAACCGATCTAGTGACTCTGTGTCTCCTAA
GCGTTCACCTTTCGCCAATGGAAGACAGAAAGAACGAGAA
CTGGAGAAGGAAAGACAAGAACAGCGAGACAGGGAGAAAA
GACGAGAGGAGGAGATGAGGGAAGAAGCTCTGAGGAAAGC
CAGAGAGAGCGACAGAGAAAAGGAGAGAAACCGTAGTAGA
AGAGAAGAAGTGTCCCATTCAGACAGGACGTCCTCCTCTA
GGTGTCAGCCTGAGAACAGACGAGGAATTAGAGGAAGTGA
GGCAGAGCAAGAGGTGCTCAAGAAAGACAGGAGAATGGAA
GAGGACAAGAGGCAGGAGAAAAGTCCCCCGCACCAAAAGA
TGGAGAAACTGGCTCAAAAAGAAAAGACTGGACAGAAAGA
CAAAGCTAAAGCTGTGAGCAGTAGCAGTAGTAGTAGCAGC
AGCAGCAGCAGTAGCAACAGTGAGAGTGATAGTGACAGCT
CCTCCTCCTCATCTTCCTCCTCCTCCTCCTCTTCCTCCTC
TTCTTCATCCTCAGATGATGACAAGAAAAAAAAGCAGAGT
TCAAAAGACAGCACCTCGGCCAGTAAGTCTGTTCCTAATG
CTGTCATCGCTCAGGCAATTGCACGCAGAGAGAAGGAGAA
CCGAGTAAGGAATGGGGAGAGTGATGAGGGCAGGAAGACT
TACCCTCCCATACAAAGACAGAGCTCACCTCCTGAGCCCC
AAAGTAAAAGAGATGATGTTGAAAAGAAGCAGCGAGACCC
TGAGAGAGAGCGGAGACCTGGTCAGTCCTCATCTTCGTTC
ACAGTAATGAATGATCGGGAACGTGGTAAAGAGAGGTACA
CTCCCACTGAGACTTCCAGCCCCCCTCTTTCTCCCCCTCA
GAGAGTCCTGGACAGAGCAGCTCAGGTTGGGGAAAGGTAC
ATGCCTTCAGGAGAAAGCCAATCTCAGAGCAGAGGTCGAG
GAGGTGAGCGATATTCACCATCAGAGCTGGAACAAGAGTC
GTCACGTCCTTCACCTAGCAGAGGAAGAGATCGACAGAGT
GACCAAAGGAAAGAGGCACCGCCTTTGTCTCCAAGAGAAA
AAGGAAGGATTGACGCCCCTCAGGTTAAACAAGCAGCTTC
TCGGCCTTCCCCAAAACGCACTCCACCAAGACAATACCAG
GACCCTCAACGTTCACTTTCCCCAAGTCCAAGACGGGGGG
TCAGAAGACTGTCACCTCCACGCAACTATTCCCCTTCTAG
ACGGGACCGCAGCCGGGAACGCCTTCGAGAACGGGACCGA
TTTAGAGCAAGACCAGCAGACAGAGATCGAGAGCGTTCCA
GGGAGAGGAGGACGAGGAACAGCAGATCAAGGAGTCCCCG
AAGACCGAGTCCTCCGTACAGATCTCGCCGTTCTCCCTCT
CCGGCACGTCGGCGCAGAAGTAGTCGCTCCTTATCAAGGG
AAAGGGAGAGAGAGCAGGAGAGGAGGAGGAATCGAGAGCG
GGACAGGCAGCGTGAACAGGAGAGAGAGAAAGAGCGAGAA
CAAAGGACAAGGGTGCCACCTAAAGATCTTACTCCTCCAC
GCCGCTCGCCATCCTCTTCCTCTAGTTCCTCCTCTTCATC
CTCACCTTCTCCTCAGAGACCCATGAGGGGTGTAAAACCA
ACTGATACAGATAAAGATAGATCAAGGGAAGCTAATGAAC
AGGCTAGGAATAAGCAACCAGAAAGGACCTCCAAACATCG
ATCTCCCTCCTCTCCTCGAGAGTCTCGCCTCTCTCTTCCT
CTGTCTTATCGTGATGTACCTGCCCGATCAAAATCACCAA
CAAGCACTGATCCTCCGGGAGGTCGGTTAAGAAGGCAATC
CCCAACATCTGTTCATGAGCCATCAGCAAGAGGAAAGACT
GCAGTAAACGGGAAATCAGAGAAAGAGAGCTCTGGCAAAC
AGCAGAAAAGAAGCAGCTCAAGTTCTTCATCCTCCTCCTC
CTCCTCCTCTTCTTCATCCTCATCATCCTCCTCATCAGAC
AGTTCAGACTCTGAAGCAGAAAAAGAAAAGGCGGGTGTTA
AAGCAAGCACAAATAAAAATGCTGGAAAGACAGCAAAAGG
AAGAGCTTCTTCATCGTCATCCTCATCTGAAAGTGAGAAA
GAAAAGAAAACAAAAAGTCCTCCACGGCCAAAAAGAGTGC
CAGCGGACTCGCTCAGAGACTCTCGGTCACTCAGTTACTC
TCCTCCAGCGAGGCAGCGAAGACCTGCACATTCTCCACCC
TCTCGACGCGTCGCAAGCAGGAAGTCGAGGAGCCGATCTC
CAGACAGTCGACGGAGGAAATGAGTGAATCGTCGTTCACA
TTTTTGTTTTCTGGACACTTACCTGACCCTCACTGGATTG
GATCTTCTGTATCCTATGGATGAGGCTAGAAATGTGACTA
GTTTTAATGGTGGTGCTCTCACCATTTGTAGAGGAAGATC
TGTCAAAGCCTGGTTCTTTGTAACTCTCCCAAAAAGGGAG
GATTTATTTTTACTTTTAATATGTTGTAATTAATGTTCAA
GCAGAGGCCAGCTGAGACACTGAAGCGCTAGTCAACTATT
GCTCTGTGCCAACAGATGCTGGACTCTATTTGTATACACA
CACACACACACAAACATGCGCAAATCACACGTCTAGTGGT
TTTCTGTCTGCTACATTGTTCTGAATGTAGATGAACTTCT
GTAATTTGCTGTTCAGAATGGATGATTTACTGTTCCTGCC
TATGTGGACAGATTCTGTTTCTTTTTGTTTATTTGTGGAA
AAGGAAGAGCTATGAATAATAAAATGGCCGTAGAATCTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations