Transcript

psmc5-002

ID
ZDB-TSCRIPT-090929-10352
Name
psmc5-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027809 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027809|OTTDARG00000021759|ZDB-GENE-030131-6547 psmc5|no_translation psmc5-002 LG_ CU459020.8 Danio rerio protein_coding KNOWN, 475 bp
GTGTTTTCAAGATGGCGCTGGACGGGATCGAGCAAATGGA
TATCGAGGACAGTAAAGGAGGCTCTGGTCTCCGACAGTAT
TACCTGTCCAAAATCGAGGAGCTTCAGTTGACAGTAAATG
AGAAAAGCCAAAATCTCAGACGCCTACAGGCTCAAAGGAA
TGAGCTAAATGCCAAGGGTAAAACTCTTTTCACCCACATT
TGGATGAATTTGATTTTAGGATGTCGACCTGAATATCTTA
ATATTCAAATGCATATCTGTTAAGCATACGCTATGAATAT
CAGCCGGATAACTTGACAGAGTGTGCTTTGTTTCAGTGCG
TCTCCTGCGTGAGGAGCTTCAGCTGCTGCAGGAACAGGGC
TCTTATGTGGGAGAGGTGGTGAGAGCCATGGATAAGAAGA
AAGTGCTGGTCAAGGTGCATCCAGAAGGAAAGTTTGTAGT
GGATGTGGATAAGAACATTGATATTAATGATGTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations