Transcript

golim4b-201

ID
ZDB-TSCRIPT-090929-10125
Name
golim4b-201
Previous Names
  • golim4b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027574 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027574|OTTDARG00000021619|ZDB-GENE-050327-74 golim4b|OTTDARP00000022585 DKEY-23H1.3-001 LG_ CT027583.9 Danio rerio protein_coding KNOWN, 2488 bp
GAAAAAGCCAATTCATAGCCATTAGTCGGACTTACTTTTT
CCGTAAGGGCTAAGTAGCCTATAATTACAGCTAGCTGTAA
GAGAAAAGTATGTAAGAAAGCAACTGGTGCGTCCATTAAA
GGGACAGCAACGCGAGCAGAAAAAAATAAACAGACGGATC
ATTGTGGCTTTCCTAAACATTTACGTCTCTGAAGAATCGG
ATGGCACATAGTCTATACTGTCTACTCAAGAAGAGGAGGA
AAAAAGATGGGGAAAGGGATTTGTTCGAGACGACAGAGAA
GAATATTTCAGTCTTTCCTCCTTGTCATCTTCGTCTGCGG
GACGTTGTGCGCCTTCATGATCTCATATGAGATGCATAAA
GAGCTGAAAAAGACTGAGGCGACCGCTTTGAAGTACCAGC
AGCATCAAGAGTCTCTTTCTGCGCAGCTGCAAGTTGTATA
CGAACACCATTCTAAACTAGAGAAATCCCTCCAGAAAGAA
AGACTAGAGCACAAGAAGGCTGAAGAGGATTTCCTCGTGT
TTAAGCGGGAGTCACAGAAGGCCCTCAACAAAGAGAAGCA
AGATTCAACCTATCGACTGAATTCTCTGCAGACAGAGCAC
CAAATACTGCAGTCCCAACATGAAGATTTGAAGATGCAGT
ACTATGAGCTTCAAGAGAAGCATCAGAATCAAGGGCAGGA
TCATGAGCGTGTTCTGGATGAACACAGGCTGAAAATAGAC
AACCTGCAGAGGGAAAAGGAGGTTGAAATATCCAGACTTA
AAGAGAACGTGTACAACCTTCGAGAGGAGAACCGACAGCT
GCGGAAAGCTCATCAGGATATCTACGCGCAGTTACTTGAC
GTGCAGGAACAGCACAAGAATCTGCAAGCTTCAAAAGACC
ATCTCTCACTGGCATTAGAAGACCATAAAAATGCAGTTGT
TGCAGCCCAGGTGGAAGGATATGAGGGAAATGGAAAAGGC
TTTTCCCCTCGAGGTGTGTTGGAGATTGAAAATAACAATG
TGACCAAAGTGGCAATGAAGCAGCCTCGGCAAATTGATAT
TTTTGCTGAGGGAAACGGCAAGAAAGAGGAGAGAAGCACA
TCAAAGGATAGAGGAGGAGAGGATAAGGGGGAAAAGGCAG
AGCTGGAACATTCCTTATCAAACCCAGAAGAGCTGGGCAT
TAACCCTCGCAACACGTTAAGCCAAAGCCTGGAGAAACAG
ACACAGACGGAGCCACTTCACACAACCAAAGCGCACTTTG
AGGCTTTGGAACCAGTTCTTGCTGGCAATGCTGTGCAAAC
ACTCCTTGGTATGGCAGGACAAGATGCAGCAAAACATGTG
GAGGATGCTCAAAAACAGGGCATAGGGAAAAACTTGAACA
CAGAGATTGAGGCCAACAACCAGAACGAAGAAGAGGATGA
AGAAGAAACCGAGTACAAGACTAATGCGGACAAGATCAGA
CCTGAAGAGGATGAACAGCTTGTGGTGGCAGGCAATCCAG
AGCCGGATGAGCAATATGTGGACGATGTGGAGGAAGAGAC
TCTTGATGAATCCGTTCTTAACAGACAGAAGAGAGCGGAG
GAAGACGAGAGCGAAGAAGATCTCTACACTGAACGTGATG
GAGTACAGGATCATGCAAACCCAGAATCAGAAACGTTTGC
CAATCAGGAGTACTTTAAAGAAAAACTAATAAAAAGAGGA
TGAAAGAGGAAAAAAGAAATCAAAAGACTGAGATGTCCTG
TCTTCTGAGTGGCTTTACACATCTCTTCTTGACTGGCGGA
AACTTAAAGTACAACTGCAACAACTCTAAAGAACTGACTA
CTTGTGCTTATGCAAGACTTATGCAAGGATTTGTTCAGCA
TTTATTTTTAATCAAGGCTTTGTGTCTTCTTGATCTTACT
AAGGCGATAGGAACTGGCATCCTGCTGATATGCATTCAAT
ATGTCGATGAATATTTGAATGATTTCTTTTGGGCAGAAAA
GTAATTATTATTTATTTTTTGTTTTAAATATTCATTCAGT
TCTTCACTTGTAAGAAACAAGTAAAATGTGTTTAAAATAA
TTTTCACTTATATTTTCACTTTATTAAAAGTAGTAATGCA
TTATTGGAACAACAAAGAAGAGGAACAAATGAAAATGTAT
TGCAAAGCTTTTTGTGTTTTTATACTTTTTAACTTGTAGT
ACTTTTCCTGTGGTGAGTTATACTTTATTGTGAAAACTTG
CACATTGGGACTAAACTTGCAAGAAACTCAAGTATTTTTG
GAACTGTAGTTTTCATGTACACTGAATTACATTCAAACAG
TTGCTTTTTACGTATTTACATGAAGCCAAACGAATATTTT
TGTTCATTTTTTTTTAGATATTGTTGAAAAGAATAATATC
AAAATGGTGCTTTAGTTAACCCCCTTTTCTCCCAACTCTT
CGCGTTCTCATTTATATGAATGTGATCTGTATTTGTTCAT
GCAAATGAGATGCTGTGTTTATTGTTTTTCTAATAAAGAT
TTTACAAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations